Sol Genomics Network

Unigene SGN-U268622

Unigene Basic Information

Unigene ID:	SGN-U268622
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	268622
mRNA sequence:	Length: 808 bp

>SGN-U268622 Solanum tuberosum #4 (3 members)
GGATTGAAGGTCAAGGAGTATGAGTTGTTGAGGAGGAACTTCAGTGAAACTGGATGCTTTGGATTTGGTATTCAGGAGCACATTGATCTT
GGTATCAAGTAAGCATGTTATTGAGATCTTGCTTTAATTCGTTATTCGGACTACTTTTTAATCCTACATATTTAGCTTAGGAGGTGCTGC
TAGCTTTTATTATGCCAAAACAATTACTCATGCGCGTTCACATATTTACCGGTTGATCATTTTCTAGAAGTGTAGTTGCTTCTTCCACGA
GTTTACAGGGAATAGTTCTTACCTTGAAAAATGTTTACTATATGAGGCCTTACCTTGAAAAATGTTTACTATATGACGCTAGGAGGTTAT
ATCAGCTGGTCATGTTGTGCTCTTATAATTCATTGACATACTATTCCTTTGTGTTAAAGGTATGATCCTTCAACTGGTATCTATGGTATG
GATTTCTATGTTGTCCTGGAACGCCCAGGATACCGTGTTGCCAGACGTCGTAGGTGCAAGTCTCGGGTTGGGATCCAACACAGGGTCACA
AAGGAGGACTCAATGAAGTGGTTCCAGGTCAAATATGAAGGTGTTATCCTTAACAAGTCCTCAAACATCCAGTAAGCCGAGAGCCGACTG
CTGGATCAGTTTATCTGATAGCAAGTTTATGTTTATGCATTTTGTAGACCAACATCTAATTACTCCCTAGAGTTGAATAGTTTTCAAGAG
TTGCTGTTATTTGGCACAGTATGCTTGTTTTCATTTTGGTTTATGAGACCAATTCAGAGCATAATATATCCTTTTTGGTTAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ235186	ribosomal protein L11

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	2
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	520	Ribosomal_L5 Ribosomal_L5_mit	34
2	22500	Ribosomal_L5 Ribosomal_L5_mit	27
5	87432		1
1.1	101834	Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	34
2	118848	Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28
5	129265	Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28

Preceding Unigenes (1)

Unigene	Build
SGN-U243576	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: