Sol Genomics Network

Unigene SGN-U279179

Unigene Basic Information

Unigene ID:	SGN-U279179
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	279179
mRNA sequence:	Length: 502 bp

>SGN-U279179 Solanum tuberosum #4 (3 members)
CTCTCACACAGATACACAGTGACACAACACAACACAACACAACCCAGCACACAATGCCTATATCACACTCTTCTTCCTTCTCCTCCTCCT
CCTTATAAATAGCAATATATTCAGTAAAGAGCCTAATTAAATCTTGAAAAATGGCACCATGTTTATCTGTACTCTTTCTTGCTTTACTTG
TTGTTTTTCTCTCTTCTCGTGTTCTTTCCCTTTCTTCATCCCATAATGAGGATGAGTTTATGTTATCTTCTGCTAAATTCCCTGTACCAA
TGGCAGAAAAACTCATCAAACAACTTAATTGTTCCCTAAACATGATATCAACAAGGCTTCATCATCACCCTTAGCAGCAACTCATCAGCA
AACTCTCTTTGAGAAGAGATTCAATTTATCTTATCTTGGTGATTCTGGGGCCACTGTTCAAGATTTGGGTCATCATGCCGGTTATTATCG
TCTTCCACATACTAAAGATGCACGGATGTTTTATTTCTTTTTTGAATCAAGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	3

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	54	Peptidase_S10	225
2	21994	Peptidase_S10	219
5	56820	Peptidase_S10 Ser_estrs	22
1.1	101427	Peptidase S10 serine carboxypeptidase - Molecular Function: serine carboxypeptidase activity (GO:0004185) - Biological Process: proteolysis (GO:0006508)	193
2	118433	Peptidase S10 serine carboxypeptidase - Molecular Function: serine carboxypeptidase activity (GO:0004185) - Biological Process: proteolysis (GO:0006508)	192
5	129360	Peptidase S10 serine carboxypeptidase - Molecular Function: serine carboxypeptidase activity (GO:0004185) - Biological Process: proteolysis (GO:0006508) Esterase/lipase/thioesterase - Molecular Function: catalytic activity (GO:0003824)	24

Preceding Unigenes (1)

Unigene	Build
SGN-U252389	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: