Sol Genomics Network

Unigene SGN-U280014

Unigene Basic Information

Unigene ID:	SGN-U280014
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	280014
mRNA sequence:	Length: 575 bp

>SGN-U280014 Solanum tuberosum #4 (2 members)
TTTTTTTTTTTTAGGGAAAAAAGGAAAGAAAATCCATTTCTGATTGGTAATAATTGTTACATGATTTGCTATACACCCAAAAGAATTTAA
ACTATTATGAATAAGAACAAAAGGATGGTGATATAATAATAATAATAATATTAAAGAAAATAAATGAACTAATTAAAGTGTTGCTGCTCT
GGCCATGGCCAAAAATTGGTGTGATCATCAACTGGAGTAAACATGTTGCAGAATCCTTCATGTTGGACGGTTGGATCAATATTATTATTC
TTGTTGCAATGGTTGAGATGATCAGGTGGTGTTGATGAGCTCTGAAGGAACTTGGCCAGAGGGACTGGGCCGGGTCCGGATGGAAAAACA
TTCTTGGAGTAAAATGGACTGTCACCTGATGATGTCCTTGTTCCCAGATTTACGTCTATGCTGTTGTTGTTGTTGTCGTCACTTCCGTTA
TTACTCCAACATCCTTCGTTTTCTTTATTCAGATTAAACATTATTGCGCCTCCGCCTGATGATTCTCTCTTCTTTACACTTAATAACTCG
GAATGAAGTTCCTTGTTTTGAGCCTTGAGTGCATC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	CSWB	Tubers	6124	1
Solanum tuberosum	MXFL	Floral buds	6603	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 1 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	60	Homeobox	203
2	22115	Homeobox HTH_lambrepressr	61
5	61672	Homeobox HTH_lambrepressr Leu_zip_homeo	4
1.1	101432	Homeodomain-related - Molecular Function: DNA binding (GO:0003677) - Biological Process: regulation of transcription (GO:0045449) Homeobox - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) Homeodomain-like	183
2	118482	Homeobox - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) Homeodomain-related - Molecular Function: DNA binding (GO:0003677) - Biological Process: regulation of transcription (GO:0045449) Homeodomain-like	93
5	132587	Homeobox - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) Helix-turn-helix motif lambda-like repressor - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) Leucine zipper homeobox-associated - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) Homeodomain-related - Molecular Function: DNA binding (GO:0003677) - Biological Process: regulation of transcription (GO:0045449) Homeodomain-like	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: