Sol Genomics Network

Unigene SGN-U283276

Unigene Basic Information

Unigene ID:	SGN-U283276
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	283276
mRNA sequence:	Length: 568 bp

>SGN-U283276 Solanum tuberosum #4 (2 members)
TTGCCCGAAGGAGCTCATCGGATTTCTACAACTCAAGATAAGTGTCCTGAATGTGACTCAACTATCATAGAAGTCGATTTCAACAAGAAA
ACAACGCCCTTAAAAGATGGAGCTACACTCCATAAGGGATGTATTCTTTGCGACGAGCTACTGCATTCACTTGTGGAAATGAAACATGGA
AGATCATTTTCTAGACATGGAAGGAGAGGACGTGGTAGAGGAAGAGGAAGAGGAAGAGGACGGGGCAGCAACAAACAACAAGACCCAAAA
ATGAGTTTCCGGGATTTCTAAAGTGTTGTTCGATAATCTTACTTGAAATTTGCATTATGATTTTGATTTTCTCATAAAATTTGTTAATTG
GAGATCATTTTGTTGAGCCGACACGTTACTTGTTTGGGATTGAGACGCAGTTGTTGTTGGAGGTCATTTTGTAGAAGTAGGAGCATACAT
ATGCTGGTTTATTTAGAGAAAAGAAATAAGATATTGACAGTTGCACTTCTAAATCTATTTTAGTGAATAATCTATCAACAATGGAATATT
AATACCCTAAAATTTCCATAAATCTATT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	2

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1499	TopoI_arch TopoIII_bact DNA_tpisomrase Toprim_dom DNA_topI_bact	13
2	25221	TopoI_arch TopoIII_bact DNA_tpisomrase Toprim_dom DNA_topI_bact	7
5	59228	TopoI_arch TopoIII_bact DNA_tpisomrase Toprim_dom DNA_topI_bact	7
1.1	101663	Zinc finger CCHC-type - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: zinc ion binding (GO:0008270)	49
2	121088	DNA topoisomerase type IA - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IA DNA-binding - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) TOPRIM - Molecular Function: nucleic acid binding (GO:0003676) - Biological Process: DNA modification (GO:0006304) DNA topoisomerase type IA domain 2 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IA central - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) Toprim subdomain - Molecular Function: nucleic acid binding (GO:0003676) - Biological Process: DNA modification (GO:0006304)	7
5	132522	DNA topoisomerase type IA - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IA DNA-binding - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) TOPRIM - Molecular Function: nucleic acid binding (GO:0003676) - Biological Process: DNA modification (GO:0006304) DNA topoisomerase type IA domain 2 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IA central - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) Toprim subdomain - Molecular Function: nucleic acid binding (GO:0003676) - Biological Process: DNA modification (GO:0006304)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U257895	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: