Sol Genomics Network

Unigene SGN-U285131

Unigene Basic Information

Unigene ID:	SGN-U285131
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	285131
mRNA sequence:	Length: 672 bp

>SGN-U285131 Solanum tuberosum #4 (2 members)
CTGAAATTGAGGCTCGTCTTGACTTCGATGACGAGATGCCACCCCTTGATCTGAATCTTACTATGGACAAAATATATGGGATGCTGCATG
ATCTGGATAATGCGCTGGAAACTGCCAACTATGACAAGCTTCTGCAGTCAGGACTACAGATTGCAATTGTTGGTCGACCAAATGTTGGGA
AATCAAGCCTTCTTAATGCATGGAGCAAACGTGCAGACTGATAGAGCAATAGTTACAAATATTGCTGGTACTACACGGGATGTTTTAGAA
GCCAATGTTTCTGTTCGTGGTGTTCCTGTTACACTTCTTGATACTGCAGGAATCAGAGAGACTGATGATGTTGTGGAAAAAATTGGTAAG
GCCTTTCTATTTGCGAGTTTATGCCATTCGAATGTTGACTGGAGCCTGCCATTTATCTGTTGAAATTTTGGTCATTGAACAAATAAAATA
TTTAGTGAACCAGATTCTTCTTCTTCTTCTTTTTTTTTTTTTTGAGAATGAATGAACCAAATCCCATTAACCCTTGAAAGGCGATTTATC
AGCTCTTATACACAGTCTGATGGCTCAATACTTCTTATGCATTTAAGTGTATTTCTGTCATTGCTACATTGATTTTCTCATCTAACTTGT
GGCATTTAGCATTTATTTAGATTGGAAACATAACTTCATTTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	184	MMR_HSR1	78
2	26700	Era Cons_hypothATPbd Small_GTP Ras_trnsfrmng ProtSyn_GTPbind MMR_HSR1 GTP-bindding_dom ARF/SAR DUF258 ThdF ArgK	5
5	63519	Era Cons_hypothATPbd Small_GTP Ras_trnsfrmng ProtSyn_GTPbind MMR_HSR1 GTP-bindding_dom ARF/SAR DUF258 ThdF ArgK	3
1.1	101549	GTP1/OBG - Molecular Function: GTP binding (GO:0005525) GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622)	77
2	122236	GTP-binding - Molecular Function: GTP binding (GO:0005525) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) tRNA modification GTPase TrmE - Molecular Function: GTPase activity (GO:0003924) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: tRNA modification (GO:0006400) Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622)	5
5	134741	GTP-binding - Molecular Function: GTP binding (GO:0005525) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) tRNA modification GTPase TrmE - Molecular Function: GTPase activity (GO:0003924) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: tRNA modification (GO:0006400) Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622)	3

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U256321	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: