Sol Genomics Network

Unigene SGN-U285509

Unigene Basic Information

Unigene ID:	SGN-U285509
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	285509
mRNA sequence:	Length: 548 bp

>SGN-U285509 Solanum tuberosum #4 (2 members)
AGACAGCGGGAGCTATGGTACTGCACTGCTGCTTCACCGGAACTACCCTCCATTCCCTCAAACTTGCTGCAATTCCTTACTTCTCCAGAA
CCCTAACCTCTCGTCTAACGCCCTACTATCCAAGGCCGCTGTTCCCTCTTGCCGTTAGATCCCTTTCTGCCGCCTCCTCCGCCGCCACCT
CCACAGACGAGTATCAAGTGGTGAAGCCCCAATGGAAAGCTGCAATTGATTTCAAGTGGATAAGAGATAATAAGGAGTCAGTTGCGGTTA
ATATTAAGAATAGGAACTCCAATGCTAATCTGGAGATTGTTCTCGAGCTCTACGAGAAGTTGCTCAGTGTTCAGAAGATAACAGGAGGTT
GAAAAGTTACGAGCAGAGAGAAATGCAGTTGCAAACAAGATGAAAGGAAAACTAGAACCCTCAGAACGCCAGAAGCTCATTGAAGAAGGA
AAGAATCTGAAGGAAGAACTTGTTACTTTGGAAGAAGACCTACTAAAACTTACAGATGAGCTGCAGCAAGAAGCGCAATCCCTACCTAAT
ATGACACA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	2

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (5)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1793	tRNA-synt_2b tRNA-synt_ser tRNA_ligase_II Pox_A_type_inc	10
2	26266	Ubiquitin tRNA-synt_2b tRNA-synt_ser tRNA_ligase_II Pox_A_type_inc	5
5	60239	Ubiquitin tRNA-synt_2b tRNA-synt_ser tRNA_ligase_II Pox_A_type_inc	5
1.1	103172	tRNA-binding arm tRNA synthetase class II (G H P and S) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Seryl-tRNA synthetase class IIa - Molecular Function: serine-tRNA ligase activity (GO:0004828) - Molecular Function: ATP binding (GO:0005524) - Biological Process: seryl-tRNA aminoacylation (GO:0006434) Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418)	7
2	121399	tRNA-binding arm Seryl-tRNA synthetase class IIa - Molecular Function: serine-tRNA ligase activity (GO:0004828) - Molecular Function: ATP binding (GO:0005524) - Biological Process: seryl-tRNA aminoacylation (GO:0006434) Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) tRNA synthetase class II (G H P and S) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418)	6

Preceding Unigenes (1)

Unigene	Build
SGN-U256308	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: