Sol Genomics Network

Unigene SGN-U286648

Unigene Basic Information

Unigene ID:	SGN-U286648
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	286648
mRNA sequence:	Length: 740 bp

>SGN-U286648 Solanum tuberosum #4 (1 members)
AGCTGCTCAGGCGAAACAGCGAACGGCGCCGGCCAGCGAGCAGCCGCGAAAACCAGCCGGCAACCGGGCGCCGCCTCCGATCCGTTCTTC
TCGCCAGCAAGCGAAGGCCGCACCGGCCAGAAGCAGCGCGAGGACCAGCTCCGACCGGCGAGCCACTTTCTCTCTTCTCCTCTGCTCTAG
TGAGGACGACAACAACAAACAGCAGCTGCAGCTGCTCTGACAAGCGAGCGGCGAGCAGCCAACTCCGGCGAAGGCAAGGTAATCACCGGC
GAACCCCATCAAAGACGACAACAACAAAAGCGAGACCCTCGCATCTCCATTCCTCTCCTCTTCGGCGAAGTTCTAGTAATCCAGGGAAAT
GAACAATGAAGAAAAACGATTTAATCAAGAAGAGGAGGATGAGGAGGAAAATGGGAGAGGTCGAGAAGCATGGGAAAGAACTTATGCAGA
TGAAAGATCATGGGAGTCTTTGCAAGAGGATGAATCAGGTCTCCTTCGTCCAATTGACAACACAACTCTATCCCATGCTCAGTATCGACG
ACGTCTCCGCACTGCAACCGCTGCACGAATTCAGAAGGGTCTGATTCGGTACCTCTACATTATCATTGATTTCTCCAGGGCAGCTGCAGA
AATGGATTATAAACCAAGCCGAATGGTTGTAGTTGCTAGACAAGTGGAGGCTTTTATAAGAGATTTTTTGACCAGAATCCCCTGAGTCAA
ATTGGCTTGGTGATCTTGAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ241844	glycine rich protein

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E487840
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	320	WD40 VWF_A Ribosomal_S18 Homeo_OAR MAGE Znf_C2H2 RNA_rec_mot Ssl1 TAFII55_N M-ppestrase Mak16 DUF16 Tfb4 Znf_ring Ssl1_like Lsm_interact Znf_HIT DBR1	50
2	26115	VWF_A Znf_C2H2 Ssl1 Tfb4 Znf_ring Ssl1_like Znf_HIT	5
5	91482		1
1.1	101572	Like-Sm ribonucleoprotein core - Cellular Component: nucleus (GO:0005634) - Cellular Component: small nucleolar ribonucleoprotein complex (GO:0005732) - Biological Process: mRNA processing (GO:0006397) Like-Sm ribonucleoprotein eukaryotic and archaea-type core - Biological Process: mRNA processing (GO:0006397) - Cellular Component: ribonucleoprotein complex (GO:0030529) Like-Sm ribonucleoprotein-related core	70
2	122935	von Willebrand factor type A TFIIH basal transcription factor complex subunit SSL1 - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281) - Molecular Function: zinc ion binding (GO:0008270) - Biological Process: regulation of transcription (GO:0045449) Zinc finger RING-type - Molecular Function: protein binding (GO:0005515) - Molecular Function: zinc ion binding (GO:0008270) Ssl1-like - Molecular Function: RNA polymerase II transcription factor activity (GO:0003702) - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281) - Molecular Function: zinc ion binding (GO:0008270) - Biological Process: regulation of transcription (GO:0045449) TFIIH C1-like C-terminal - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281)	4
5	133136	von Willebrand factor type A TFIIH basal transcription factor complex subunit SSL1 - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281) - Molecular Function: zinc ion binding (GO:0008270) - Biological Process: regulation of transcription (GO:0045449) Zinc finger RING-type - Molecular Function: protein binding (GO:0005515) - Molecular Function: zinc ion binding (GO:0008270) Ssl1-like - Molecular Function: RNA polymerase II transcription factor activity (GO:0003702) - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281) - Molecular Function: zinc ion binding (GO:0008270) - Biological Process: regulation of transcription (GO:0045449) TFIIH C1-like C-terminal - Cellular Component: nucleus (GO:0005634) - Biological Process: DNA repair (GO:0006281)	4

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U259037	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: