Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U286732

Unigene Basic Information

Unigene ID:	SGN-U286732
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	286732
mRNA sequence:	Length: 358 bp

>SGN-U286732 Solanum tuberosum #4 (1 members)
CAAAACTCTTTCATTTGCTTCTTTCATTCTACACTCATTTCAACATTTTCTCCATTTTTTCTTTTCTCATTTCTTTCCTCTCAAAGTTGA
ACTTTGTCTGAGGATTTCCCATCTGCTGGATCAACTGCAATGGCTGAACGTGTTCTGACTCGTGTTCATAGTCTTCGTGAGCGTGTTGAT
GCAACTTTAGCTGCTCACCGCAATGAGATACTGCTTTTTCTTTCAAGGATCGAAAGCCANCGGAAAAGGGGGATCTTGTAAACTCTCATG
CAGCTTTTCGGCCTGAGTTAGATGCAATTCTCCAAGATGACAAAAACAAACTGAATGAACATGCATTTGAAGAAACTCCTGAAATCCA

[Blast] [AA Translation]

Associated Loci (2)

Locus symbol	Locus name	Gene activity
sus4	sucrose synthase 4	sucrose synthase
STU21129	sucrose synthase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E443059
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	249	Glyco_trans_1	63
2	22268	Sucrose_synth Glyco_trans_1	39
5	56483	Sucrose_synth Glyco_trans_1	38
1.1	101551	Glycosyl transferase group 1 - Biological Process: biosynthesis (GO:0009058)	76
2	118674	Glycosyl transferase group 1 - Biological Process: biosynthesis (GO:0009058) Sucrose synthase plants and cyanobacteria Sucrose synthase - Biological Process: sucrose metabolism (GO:0005985)	37
5	129145	Glycosyl transferase group 1 - Biological Process: biosynthesis (GO:0009058) Sucrose synthase plants and cyanobacteria Sucrose synthase - Biological Process: sucrose metabolism (GO:0005985)	36

Preceding Unigenes (1)

Unigene	Build
SGN-U258965	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: