Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U287603

Unigene Basic Information

Unigene ID:	SGN-U287603
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	287603
mRNA sequence:	Length: 532 bp

>SGN-U287603 Solanum tuberosum #4 (1 members)
CAAAGACACTTAACAGAGGAATTTCAGAATTTGTTGTCATGGCCGCTGATACTGAGCCCCTTGAAATCCTTCTTCACCTTCCACTCCTTG
CTGAAGATAAGGTGATTTATTTTTCCTTTTTCTTTAAAAATTTCTATTCTTTCACCCTTGTTGATATTGCTCCTTTTTTAATTGAGTAAT
GGACTAAACAGCTCCAAATAGAGGTAGTGAATATTGAGAATATATATGAGGGACTCTGGCTAGGTCAAGATTAATACATGTCTCTTCTTT
TTCTGGTGTAGTTATTGGCATTTTAAAGAGTTGTGTTTGTTATTCTTTTGTTGTTATATTGTGTGAGGTTACATTGTTCTGATTTCAGAC
TATGGAAATTGGAAACCATGTGTATATTATGCACTTTCCGCTCTATTAACTCATCATTTTGAAGAGCTGTATTAAACGAGAGTATTGTAG
CTACCTACTAGGATTTTTTCCCTACCTAAGGTTCGGAAGCGAGATCTCTAGTTAAGAGTGGAACATCGTATACATTCTACCA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E438087
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	281	Ribosomal_L30e Ribosomal_L7A	56
2	23286	Ribosomal_L30e HMG_nuclear Ribosomal_L7A Ribosomal_L7Ae Ribosomal_HS6	14
5	57357	Ribosomal_L30e HMG_nuclear Ribosomal_L7A Ribosomal_L7Ae Ribosomal_HS6	14
1.1	102177	Ribosomal protein L7Ae/L30e/S12e/Gadd45 Ribosomal protein L7AE - Cellular Component: ribonucleoprotein complex (GO:0030529) - Biological Process: ribosome biogenesis and assembly (GO:0042254) High mobility group-like nuclear protein	20
2	119740	High mobility group-like nuclear protein Ribosomal protein L7Ae/L30e/S12e/Gadd45 Ribosomal protein L7AE - Cellular Component: ribonucleoprotein complex (GO:0030529) - Biological Process: ribosome biogenesis and assembly (GO:0042254)	13
5	130063	High mobility group-like nuclear protein Ribosomal protein L7Ae/L30e/S12e/Gadd45 Ribosomal protein L7AE - Cellular Component: ribonucleoprotein complex (GO:0030529) - Biological Process: ribosome biogenesis and assembly (GO:0042254)	13

Preceding Unigenes (1)

Unigene	Build
SGN-U259782	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: