Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U288343

Unigene Basic Information

Unigene ID:	SGN-U288343
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	288343
mRNA sequence:	Length: 524 bp

>SGN-U288343 Solanum tuberosum #4 (1 members)
CTCTCCACTTAACTTTCTCTTCTTCAAGACCCAGTTTTTCTTCATCATGTTCAGTAAAATTGAATTCTTGTTTTATGGGTGTTTCAAAAT
TGAAAAGTATAGGATGGTGTAGACCAAGTGGATTAGGGCCAAATTGTGGTTCAAGAACTACTTGTTGGTTTAATTTCAGACAAAATGCTG
AAACTGCTGGAGTTTATGGTAGTCAATCTCGTGATGATTTTGATAGAGATGATGTTGAGCAGGTGGGGTTTCTTTAATTTTTCTCTAAAT
GCTAAATCTTGATGTGTTTTGAGTACTAAATTCTTAACATTTGAGTTGTTGCTGTTTTTTTGGATGCTTTGTGCATAGGACTGCCCTTTT
TTTTTTAAGTTGAGAGTTAAAGATTTAAGCTTTATGTGTTCGACCTTAAAAAATGTTTTTTTTTGGAATTATGAGTAGAGCCTTATCGTA
ACTTGGTAAGTTGTTGTCAGTGTGATCAGGAAGTCATGGTTTCAAGTCTCTTGCAGAAATGCAAGGTAAGGCTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E443095
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	18620		1
2	50268		1
5	91916		1
1.1	102135	Ribosomal protein S17e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	21
2	119082	Ribosomal protein S17e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	21
5	129451	Ribosomal protein S17e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	21

Preceding Unigenes (1)

Unigene	Build
SGN-U260201	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: