Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U290901

Unigene Basic Information

Unigene ID:	SGN-U290901
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	290901
mRNA sequence:	Length: 657 bp

>SGN-U290901 Solanum tuberosum #4 (1 members)
AACTAGTGGATCCCCGCGCTGCAGTAATTGATGGCCCATATGGAGCACCAGCACAAGACTATAAGGAATATGAGGTGCTTTTGTTGGTAG
GTTTAGGAATTGGAGCCACCCCTATGATAAGTATTGTTAAAGACATAGTGAACAACATGAAGGAAGAAGAGTATGATCATGATTTGGAGA
AAAAAACAGTGTCAGGGAGTGGAAGATCAAACTTCAAGAGGGTATATTTTTATTGGGTTACTAGAGAACAAGGTTCATTTCGATTGGTCT
CAAGGGTCTTAATGAATGAGTTAGCTGTAATGGATTGTGATGGAATAATCGAGATGCATAATTACTGTACAAGTGTTTATGAAGAAGGTG
ATGCTCGCTCTGCTCTCATCGCGATGCTTCAGTCTATCAATCATGCCAAAAATGGCGTAGACATTGTATCTGGAACAAGAGTTAAGACTC
ATTTTGCTAGACCTAATTGGAGAAATGTCTACAAACGCATTGCTCTTAATCACACTGATGCAAGAGTTGGTATGTACTTGAAACTTCGTA
TAATTTTATATATTCTTTAAGAATTTCAACTATATATATGTATAGGCACAATAATTAAACACGCTTTTTAACTTGACATCAGCTGGAATC
TATATCCTTCAAGTTAGAAAAGCGAAG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
strbohd	StrbohD NADPH oxidase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	MXLF	Leaves	6585	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E615943
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	250	Ferric_reduct	63
2	22391	GP91PhoX Ferric_reduct EF-hand	32
5	56567	GP91PhoX Ferric_reduct EF-hand	32
1.1	101616	Ferric reductase-like transmembrane component N-terminal FAD-binding 8 Ferric reductase-like transmembrane component - Biological Process: electron transport (GO:0006118) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491)	57
2	118797	NADPH oxidase Respiratory burst Ferric reductase-like transmembrane component - Biological Process: electron transport (GO:0006118) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Cytochrome b-245 heavy chain - Biological Process: electron transport (GO:0006118) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Ferric reductase-like transmembrane component N-terminal FAD-binding 8 EF-Hand type - Molecular Function: calcium ion binding (GO:0005509)	29
5	129233	NADPH oxidase Respiratory burst Ferric reductase-like transmembrane component - Biological Process: electron transport (GO:0006118) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Cytochrome b-245 heavy chain - Biological Process: electron transport (GO:0006118) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity (GO:0016491) Ferric reductase-like transmembrane component N-terminal FAD-binding 8 EF-Hand type - Molecular Function: calcium ion binding (GO:0005509)	29

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: