Sol Genomics Network

Unigene SGN-U291665

Unigene Basic Information

Unigene ID:	SGN-U291665
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	291665
mRNA sequence:	Length: 677 bp

>SGN-U291665 Solanum tuberosum #4 (1 members)
TGGAAATGAAAGATCGGCAAGGGACTTCCATTCAGTTTTGGCCTGATAAAGAAGTATTCACAACTGAAATACAATTTGACTATAACACCA
TAGCTGGGAGAATTAGGGAGCTTGCTTTCCTCAATCCCGAGCTCACAATTGTTCTCAAGAAGGACGACATAGATCCGGAGAAGATCCAAC
ATGCTGAGTACTTTTATGCTGGAGGATTGGTTGAATACGTGAAATGGCTGAATGCAGACAAAAAACCACTTCATGATGTGCTGGGATTCA
GAAAAGAAGCTGATGGAATCACGATTGATATGGCTCTTCAATGGTGCTCAGATGCTTATTCAGACACGATGCTAGGTTATGCAAACAGCA
TACGGACGATTGATGGTGGCACTCACATAGATGGTGTGAAAGCTGCCCTAACAAGAACACTCAACAGTTTGGGGAAGAAGTCAAAGACAA
TCAAGGAGAAGGATATAAACTTGAGCGGCGAGCATGTGAGAGAGGGATTAACTTGTGTTATCTCTGTTAAAGTTCCGAATCCAGAATTTG
AAGGACAAACTAAGACTAGGCTGGGAAATCCTGAGGTAAGAAAAGTGGTCGATCAGTCAGTTCAAGAGTATCTGACTGAGTATCTGGAAT
TGCATCCAGATGTGCTAGATTCGATTCTTTCCAGTCACTAAATGCTC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E450366
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	372	Myb_DNA_binding	45
2	24575	DNA_topoisoII TopoIV_B_Gpos DNA_gyrB	8
5	58608	DNA_topoisoII TopoIV_B_Gpos DNA_gyrB	8
1.1	101724	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	43
2	121711	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit B region 2 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit B - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265)	6
5	131931	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit B region 2 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit B - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U265479	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: