Sol Genomics Network

Unigene SGN-U296159

Unigene Basic Information

Unigene ID:	SGN-U296159
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	296159
mRNA sequence:	Length: 520 bp

>SGN-U296159 Solanum tuberosum #4 (1 members)
CTATCACTTTTCTCCATTTCAGAAGAAGCGAGAAAAAAGTTGCGAGCAATGTGTGGAATACTTGCAATTTTCGGTTGCACTGATAATTCT
CATGCCAAGCGTTCAAGAATCATCGAACTATCAAGAAGGTTGCGCCATAGAGGACCTGATTGGAGTGGATTGCATAGCCATGAGGACTGT
TATCTTGCTCATCAACGATTGGCAATAGTAGACCCAACTTCAGGAGATCAGCCGCTGTATAATGAGGACAAGACCATTGTTGTTGCGGTA
AATGGAGAGATCTACAACCATAAGGAATTACGGGAGAAACTGAAGTCTCATCAGTTTCGAACTGAAAGTGATTGTGAAGTTATTGCCCAT
CTTTATGAAGAATATGGAGAAAACTTCATTGACATGTTGGATGGGATGTTCTCTTTTGTTCTTCTTGATACCCGGGATAAAAGTTTCATC
GCTGTTCGGGATGCCATTGGCATTACACCCCTTTATATGGGGTGGGGTCTTGATGGCTCCATATGGTTTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E438936
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	248	Amd_phspho_trans GATase_2 Asn_synthase Asn_synth_AEB GlmS	63
2	22898	Amd_phspho_trans GATase_2 Asn_synthase Asn_synth_AEB GlmS	18
5	57029	Amd_phspho_trans GATase_2 Asn_synthase Asn_synth_AEB GlmS	18
1.1	101594	Glutamine amidotransferase class-II - Biological Process: metabolism (GO:0008152)	65
2	120029	Asparagine synthase - Molecular Function: asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066) - Biological Process: asparagine biosynthesis (GO:0006529) Asparagine synthase glutamine-hydrolyzing - Molecular Function: asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066) - Biological Process: asparagine biosynthesis (GO:0006529) Glutamine amidotransferase class-II - Biological Process: metabolism (GO:0008152)	11
5	130319	Asparagine synthase - Molecular Function: asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066) - Biological Process: asparagine biosynthesis (GO:0006529) Asparagine synthase glutamine-hydrolyzing - Molecular Function: asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066) - Biological Process: asparagine biosynthesis (GO:0006529) Glutamine amidotransferase class-II - Biological Process: metabolism (GO:0008152)	11

Preceding Unigenes (1)

Unigene	Build
SGN-U267563	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: