Sol Genomics Network

Unigene SGN-U298512

Unigene Basic Information

Unigene ID:	SGN-U298512
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	298512
mRNA sequence:	Length: 487 bp

>SGN-U298512 Solanum tuberosum #4 (1 members)
AATGTGTTGTGTTAGAGGGAAATTGGATATGCAGGATCCTAACAAGTCAGTTAGGGACCCAGTATATTACCGTTGCAATCAGACTCCTCA
CCACAGGATTGGTTCTAAATATAAAGTATACCCTACTTATGACTTTGCATGCCCATTTGTAGATGCTTTTGAGGGTATTACACATGCACT
TCGATCTAGTGAATATCATGATAGGAATGATCAGTATTATTGGATTCAAACTGATATGGGTTTCAGAAAAGTTCATATTTATGAATTTAG
TCGGCTGAATTTGGTCTATACACTTCTTAGCAAGCGTAAGTTGCTGTGGTTTGTGCAAAATGGACTGGTCGAAGGGTGGGATGATCCTCG
TTTTCCGACCGTACAAGGGATTGTGCGCAGAGGGCTGAAGATTGAGGCGCTGATACAGTTCATTCTTGAACAAAGAGCATCAAAGAATCT
CAATCTAATGGAGTGGGACAAGCTATGGGCCACTAAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E448574
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	376	Ribosomal_L35AE Glu_tRNA-synt_1c	45
2	22463	Ribosomal_L35AE	28
5	58438	Cys_tRNA-synt_1a GltX_arch tRNA-synt_I Glu_tRNA-synt_1c GltX_bact GlnS	8
1.1	101742	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424)	41
2	118818	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28
5	132089	Glutamyl-tRNA synthetase archae/euk cytosolic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Ribosomal protein L25-like Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424) Glutathione S-transferase C-terminal-like	6

Preceding Unigenes (1)

Unigene	Build
SGN-U266791	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: