Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578757, SGN-U589945, and SGN-U593329 in the current build, Tomato 200607 #2

Unigene SGN-U316718

Unigene Basic Information

Unigene ID:	SGN-U316718
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	316718
mRNA sequence:	Length: 802 bp

>SGN-U316718 Tomato 200607 #1 (25 members)
AGTTCTTCAGCTTTTGCTGTTGTTGTAGAGAGTGTGAGAAATACAGAAAAAAAAAGCCATGGCAGGAGCTTGCTTATCTTCTTCTTGTTT
GAGTTTTTCTACAAAATTCAACACCCTTTCTCTCAATGGACCACATGCTGATGCATTTAGGTCACTCAGTTTTTCTGCTAACACTTCTCT
CAATCTGTTCTCTAAAGGGACTGTTTCAGTGAATCCGGTGCAAATGCCGTTTCGTCGTTCCATTGTTTGTGAAGCTGCTCCAACAAAGAA
AGCGGATTCTGCTGCTAAAAGGGCAAGACAAGCTGAAAAGAGGAGAATTTACCACAAGGCTAAAAAATCTGAAGTCAGGACTAGAATTAA
GACTGTTTTGGAAGCATTGGAGACATTGAGGAAGAAAACTGATGCAGAGTCAGAGGAAGTTGTTTCAGTTGAGAAGTTGATTGCAGAGGC
ATATTCTGCAATCGATAAAGCAGTTAAAGTTGGAACACTTCACAGGAACACTGGTGCGAGAAGAAAATCTCGTCTTGCTAGAAGAAAGAA
AGCAGTTGAGATTCATCATGGCTGGTATGTTCCTGCTCCAGCCACTGAACCTGATCTTGTAGCCACAGCTTGATGTCAATCCATATTTTT
CATATTCAATGTAAAGCAGTGACATCTTGTGGAGAATTCAACTTCCTAGAGTATGATCAGATATTTTTCATTCTTGATATTGTATATGAC
CTTTTTGTGCAATCAATTTCTACTTCTCTTTTGTTTCTTCAGTTAAAAAAAATGTGTCTTTCATTAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (11)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	4
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	5
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (25)

Alignment image suppressed for unigene with 25 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (4)

Annotations (manual: 1 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	104383	Ribosomal protein S20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S20p - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: rRNA binding (GO:0019843)	4
2	123461	Ribosomal protein S20p - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) - Molecular Function: rRNA binding (GO:0019843) Ribosomal protein S20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	4
5	135638		3

Preceding Unigenes (1)

Unigene	Build
SGN-U215907	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: