Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U574776 in the current build, Tomato 200607 #2

Unigene SGN-U320585

Unigene Basic Information

Unigene ID:	SGN-U320585
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	320585
mRNA sequence:	Length: 1304 bp

>SGN-U320585 Tomato 200607 #1 (10 members)
TTATCACAAACCAAAATGGGAGGTGGTGGTAATATGACTAAAATTGAACAAAAGATTAAAGTACCACTATCCAAGCCCCCTTTTATACTT
AGTGAACTCAAGAAGGCTATTCCTCCTCATTGCTTTCAACGATCTCTCGTTCGCTCCTTTTCCTACGTTGTTCGGGATATCACACTAGTG
TTTGTATTAGGGTATATCGCTGCGAATTACATCTATGTCCTTCCATCTCCATATAATTACCTAGGATGGCCTATTTATTGGTTTTCCCTA
GGAAGTGTTTTCACAGCAATGTGGGTCATTGCTCATGAATGTGGCCATCATGGCTTTAGTAATTACCAATGGATAGATGACACGGTTGGT
TTTATCTTCTATACCTCAATTTGTGTCCCTTACTTTTCTTGGAAATACAGTCATCGTCGTCATCACTCCAATGCAGGTTCGCTTGAATAT
GATGAAGTCTACGTACCTAGGCTTAAATCCGAATTACGTTGGTTCTCTAAATATTTCGACAATCTACCAGGACGAATAATCGCGTTCACC
ACCACCCTCACGGTTGGTTGGCCTTCTTACATGGCCATCAATGCCTCCGGTAGACCTTATGATCGTTTTGCAAGTCACTATAATCCATAT
AGTCCAATGTATAACAATCGTGAGAGGCTACTTATCTACTTCTCAGACTTAGGTCTAATTGCATTTATTTATATGTGGTATCGTATCGCG
ATGGTAAAAGGGCTAGCTTGGGTTGTATGTATGTATGTAGCACCCCTTGAAATTATGAACATACTAGTAGTGGTACTAACTTTTTTGAAC
CACACACATGCATTAGTCCCACATTATGATTCTTCAGAATGGGATTGGCTAAGAGGAGCTTTAGCTACTGTAGATAGAGACTTTGGTCCA
CTAAATAATATATGTCATAATGTTACAAATACTCATGTTTTGCATCATTTATTCACAACCATACCACATTATCATGCAGTGGAGGCAACA
AAAGCTATCAAGCCAATACTTGGAGATTACTATAATTTTGATAGTACACCAGTTTATAAAGCAATATGGAAGAATATAAATGAGTGTATC
TATGTGGAGAAAAATGAAGAAACTCAAGATAGAGGTGTTTTTTGGTATAAAAACAAACTCTAAAAGATGAATGTAAGCATTTAATTATTA
CTTGTAATTTGGCTAAATGTTAAGCCTTAATAATTTGTTATGGTTTAATTAAGGTTTACTTATAGCTTGTAATAATTGGATTGTTGCATT
TAGAAATCTCCCTAATAAATCATAACACTCTGTCCGTAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (5)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOS	suspension cultures	8026	2

mRNA member sequences (10)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101541	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	81
2	118579	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	50
5	129185	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	33

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U218869	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: