Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0206B16_T7_369475

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0206B16_T7_369475
Primer
T7
ID from Seq. Facility
LE_HBa_206_B16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
7 trimmed for vector and quality, 1021 raw
Sequence
>LE_HBa0206B16_T7_369475 (raw untrimmed)
NGGGTCTGCCGGGGATCTCTGAGTCCACTGCAGGCATGCAAGCTTGGAATTTGCTTCCTTAGATTTCCTTTTGGGCCCGTATCGACACAAATTGAAGTTA
CACAAGGATCTTTGAACGACTTTCCTCGTGAAGGAAGGTTCCACTTTGTGAGTCTAAGAATACAGAATCGCGCCGGTTCATTTTATGTGATATTATATTC
TT
TTTGATCAGTCCCAAAAAGAATGTCACATTTTTTATATGGTAAAGATTTAAAGGTACGATACCTCTATGACCTTTACTGGTCCCACTTAAGTTGAATA
GTACTCTAATCCATTTATGACGAGAGAGAAGAGTGAATTTATTTTTTTACCGGGCCAACTGATGAGCATGTCAAAGTATTTATAATTTCATAAAGTTGGT
ATCCGGCCAAATATTGACACATTAGATGAAATAGAGGGGTATAAGATTTTTGCTAACTTTCTTTTGTCTCTTGTTTTTTTTAAAGAAAAAATCCTTATGA
CATAGCTAATCTTCATCGAGATCCGAACTAATCCAAATTTATATCATATAAAGGCTACTAAAGAAATCAATTCGCGGCTCACCAAAAATTGGAGGTATAC
TTGAAACTCGAGTTTGAAACCTTTAATTCGTAAAAGAAAACTATATTCTAGCCCCTGAATATCTAATTTTTTTCTTTTTCGAAAAGCGGGAGGGGGGACA
TAAGCTTTCCTACAGGAACCATGGTATGGGAAATCCAATACTCCATCTGGCCAAGTCTTTCTAACCTCTTAAACTATAGTCTTCCTTTAAGTTTTCCTAA
AATTAACCTCCCCCTTAAAAGAATAATTCCCCCTGGACTTGGGCTTTCCTTAGCCCCTTTTTTTTAATCCAACAATTTTTTCCCCCCCCAAAATATAAAA
ACTCGCCGGAAAAATTCAACTAATTTTAAAAAGTGTTCCACTATGGATTTCCTTTCCAAAAAACAGTATTTTTTTCCCAACACTTTTAGTTTAAAAGAAA
AATACCTTTTTGGATACTTTA
>LE_HBa0206B16_T7_369475 (trimmed for quality and cloning vector)
TTTGATC

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.497481
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0206B16
Clone
Clone name
hba-206b16
LE_HBa0206B16
C10HBa0206B16
P206B16
Clone type
BAC
Contamination
none
Estimated length
118,023
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found