Sol Genomics Network

Unigene SGN-U282924

Unigene Basic Information

Unigene ID:	SGN-U282924
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	282924
mRNA sequence:	Length: 723 bp

>SGN-U282924 Solanum tuberosum #4 (2 members)
CGAGTGCTATCTTATCCTTTATATGAAACTTTGGCAAGCACGGAAGGAAAACTGATCTTAGAAGATGGAGTCTCTGAAGTTGCTAAGAGC
TTGTTAGCGGCCTATGACAGTGGCGAGCTCTGTGGTGCACTTGCAGAAGGCCAACCTGGATGGAAAAACTGGGTGAAGAAGTTCGGTAAA
TTGCTGAAGCGCAAGGGAAAATCTCTCTTCATGCCCCTTCGGGTGTTGCTAACAGGAAAGCTTCATGGACCTGATATTGGGGCCACCACA
GTGTTGCTCTATAAAGCTGGAACATCTGGCTCTGTAGCACCCCAAGCTGGGTTTGTTACATTTGATGAAAGATTTAAGATATTGAGAGAA
ACTCAATGGGAGTCGTTCAGCTCAAATGTGCCTTTGTCTGCTGGTGCTATAACGCATTGAGATTGTGGCGATATTCTGTTTTGATTATCC
ATTGTATGACTTCTACCTCCACCATTCCCAGTAGAAACAAAGAGGAGCTGCGAGCACAAGGGGGATTTTCTTGTGTTTGCATCTCCTCGT
CTGGAATCAAAGAGGGCTACCATCTCTAGTGGGATTCCTTTTCTGTATCTTCCCCCTCCCCCTCCCCCTCCACGTGTAAGGCTGTGCTGA
TTGTGACACTACGTTTATTTTTCACCGAACAATGGTAGAATAGTTAACAGGGCATTGCAGCTCCAAACTGGGTTTCATTGCATAAAAAAA
AAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ268859	glutamate tRNA ligase

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	MXLF	Leaves	6585	1
Solanum tuberosum	TUBS	Tubers	5976	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	376	Ribosomal_L35AE Glu_tRNA-synt_1c	45
2	25378	GltX_arch tRNA-synt_I Glu_tRNA-synt_1c GltX_bact GlnS	6
5	59399	GltX_arch tRNA-synt_I Glu_tRNA-synt_1c GltX_bact GlnS	6
1.1	101742	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424)	41
2	122768	Class I aminoacyl-tRNA synthetase anticodon-binding - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: aminoacyl-tRNA synthetase multienzyme complex (GO:0017101) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424) Glutamyl-tRNA synthetase bacterial/mitochondrial - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424)	5
5	132952	Class I aminoacyl-tRNA synthetase anticodon-binding - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: aminoacyl-tRNA synthetase multienzyme complex (GO:0017101) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424) Glutamyl-tRNA synthetase bacterial/mitochondrial - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: