Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579122 in the current build, Tomato 200607 #2

Unigene SGN-U312380

Unigene Basic Information

Unigene ID:	SGN-U312380
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312380
mRNA sequence:	Length: 749 bp

>SGN-U312380 Tomato 200607 #1 (63 members)
CCAAACCAAAGATTTCAAAGAAGTAAAAAAAAAAAATGGCTAGTATTCCTAGTACCATAGTTAACACTAGTTTCTTGCCAAGAAGAAGTG
TTGTTACTAGCCTTAAATCCATACCAAATGTTGGTGAATCTCTCTTTGGTCTTAAAAGTGGTAGAAGTGGAAGGATTACTTGCATGGCTA
CATACAAAGTGAAGCTTATTACACCAGAAGGACCTTTTGAATTTGATTGTCCTGATGATGTCAGCATTCTTGATCGGGCGGAGGAAACGG
GGCTAGATCTTCCTTATTCATGTAGGGCTGGTGCTTGCTCATCTTGTGCTGGAAAGGTTACTGCTGGAAGTGTTGATCAGTCTGATAACA
GTTTTCTTGATGATGACCAAATAGATGAAGGATTTGTGCTCACTTGTGTTGCTTATCCAAAGTCTAATGTTACCATTCAGACTCACAAGG
AGGAGGACCTTGTTGGCTAACTAGTATTTTACTTCTTTTCTTATCAATAATTAAATTAGGTGCTATGTACCTCTTTTATATAAGTCAATG
ATGACTTGTACCATAATGATTTATGGAAGAATTAATAATTTTCTATTTTTAAAAAAAAAAAAAAAAATTGTTGTTGACAAAGCCTGTTGC
CTTTCTCATTTGTAAATGTTCTGAACGACTCCTAAATTACTCTTAAGGTGTAAGGTCTTCCGTGCCTGTTTGTAAATATAATGCTGTGCC
GTGCCTAAACAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (12)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	LB	Leaf Mature leaves	3316	9
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	8
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	18
Solanum lycopersicum	cLER	leaf 4 weeks	5127	3
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	11
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	7
Solanum lycopersicum	cTSB	seed	1880	1

mRNA member sequences (63)

Alignment image suppressed for unigene with 63 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (8)

Annotations (manual: 3 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101478	Lactate/malate dehydrogenase - Biological Process: tricarboxylic acid cycle intermediate metabolism (GO:0006100) - Molecular Function: oxidoreductase activity (GO:0016491)	110
2	118552	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin [2Fe-2S] plant - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118)	56
5	129094	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 2Fe-2S ferredoxin iron-sulfur binding site - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin [2Fe-2S] plant - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118)	42

Preceding Unigenes (1)

Unigene	Build
SGN-U212712	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: