Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577227 and SGN-U580133 in the current build, Tomato 200607 #2

Unigene SGN-U313492

Unigene Basic Information

Unigene ID:	SGN-U313492
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313492
mRNA sequence:	Length: 1627 bp

>SGN-U313492 Tomato 200607 #1 (80 members)
GGCGATTGGCGGCCAATCGGCCGAATTGATCAAAAAATCAAATTTTCTTTTTCATAATAAAATTAAAATATTCTCTCTCTTTTTTTTTTT
CATAAAGAAACAAAAAAAGAGAGTGTGTGGGGTGAAAGGAGGAAGAAGGGTGCTTTTGCTTTTCTCGAGGTTTGGGATTGAAGAGGCAGC
GTAGCGAAAATGGGAGCTGGTGGTCGTATGTCTGCTCCAAATGGCGGGACTGAAGTAAAGAAGAATCCTCTTCAAAAGGTACCAACCTCG
AAGCCCCCTTTCACAGTTGGTGATATTAAGAAGGCTATCCCACCTCACTGCTTTCAAAGGTCTCTCATCCGCTCATTTTCATATGTTGTG
TATGACCTCATACTCGTATCCATCATGTACTACGTTGCAAACACTTACTTCCACCTCATTCCATCACCATATTGCTACATTGCATGGCCT
ATTTACTGGATTTGCCAGGGTTGTGTTTGCACTGGAATTTGGGTTAATGCCCACGAATGTGGCCATCACGCCTTCAGTGATTACCAATTG
GTTGATGACACCGTAGGACTTATCCTTCACTCTGCTCTATTGGTGCCGTACTTCTCTTGGAAATATAGTCATCGTCGCCACCACTCCAAC
ACTGGCTCCCTCGAGCGTGATGAAGTCTTTGTGCCTAAGTCTAAATCCCAGCTCGGATGGTATTCCAAGTACTTGAACAATCCACTAGGC
AGAGTTATCACACTCACAGTCACCCTCACTCTTGGTTGGCCGTTGTACTTGGCATTCAATGTATCTGGCAGACCTTATGACCGATTTGCA
TGTCACTATGACCCTTATGGCCCAATCTACAACAACCGCGAGAGGCTACAGATCTTCCTTTCTGATGCTGGAGTTCTCGGAGCTTGTTAT
CTGTTATACCGTGTTGCCTTAGTGAAAGGTCTAGCTTGGCTAGTGTGCATCTACGGTGTGCCCCTTCTAGTCGTGAACGGCTTCCTTGTC
CTGATCACCTACTTGCAGCACACTCACCCATCACTGCCTCACTACGACTCAACCGAGTGGGATTGGCTTAGGGGAGCTTTGGCAACCTGT
GACAGAGACTATGGTGTTCTAAACAAGGTCTTCCACAACATCACCGACACTCACGTGGTGCACCATCTGTTCTCAGCCATGCCACACTAC
AACGCGATGGAGGCAACCAAAGCAGTCAAGCCACTACTCGGAGACTACTACCAATTCGATGGTACCCCCATTTTCAAGGCAATGTGGAGG
GAAGCTAAAGAGTGTCTCTACGTCGAGAAAGACGAATCATCTCAAGGCAAAGGTGTCTTCTGGTACAAAAACAAGCTCTGAGAACACTAG
AACAGAAACTCAGCTTGCTTTGTATTGGTCTTTTGGTACTGTTTGGTCTCTCTGTGTCTTAAGTATTTTGGATTTAAGTTAATTTAGCTA
ATGTGTTGTCTTTGCTAGTGAGGGGAGGTTTATGTTTGATGAATTTTTTTTGATAAATCAAAGGACAAAAAATTTAGAAAAATGTAAAGA
GGATCAAAATGCATCCTCCACCTCCTCCTAGTATGTAATAAACTACCAGTTTTAATATAAATGGTTGTGTTTGTGTCTAAAAAAAAAAAA
AAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	5
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	10
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	6
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	8
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	4
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	4
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	8
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	cTSC	seed	2256	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (80)

Alignment image suppressed for unigene with 80 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 2 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101541	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	81
2	118579	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	50
5	129185	Fatty acid desaturase subdomain - Biological Process: fatty acid desaturation (GO:0006636) - Cellular Component: membrane (GO:0016020) - Molecular Function: oxidoreductase activity acting on paired donors with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717) Fatty acid desaturase - Molecular Function: oxidoreductase activity (GO:0016491) Fatty acid acyl-CoA desaturase - Biological Process: fatty acid biosynthesis (GO:0006633) - Molecular Function: oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen (GO:0016705)	33

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U213622	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: