Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U581082

Unigene Basic Information

Unigene ID:	SGN-U581082
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 777 bp

>SGN-U581082 Tomato 200607 #2 (64 members)
GCCGGGGAACACTTACAAGGCAACGCACCAAATCCACACAAACGAATAATATCCAATTCTCTCTAGAGGTTTCATCATGAAAGGAGCTAA
ATCAAAGGCTAAAGCTGATACCAAGCTTGGTGTAAGGAAGAAGGCTACTGAGAGTAAGAAGGCGAAGAACGCTGCTAAGGATCCAAACAA
GCCTAAGAGGCCTCCAAGTGCCTTCTTCGTTTTCATGGAGGAGTTTAGGAAGACCTACAAGGAGAAGCACCCAAACAACAAATCTGTTGC
TGTTGTTGGCAAAGCTGGTGGAGACAAGTGGAAACAGTTGTCAGATGAAGAGAAAGCTCCTTACCAAGCCAAGGCTGAGAAGAGGAAGGC
TGAGTACCAAAAGAGCATGGATGCATATAACAAGAAACTGGCTGCTGGTGATGCTGATGATGAGTCTGACAAGTCCAAGTCTGAGGTACA
TGATGATGATGAGGACGATGATGGAAGTGAAGAGGAGGATGATGATTAAACAATCAGTAGGCTGTTGAAATTCAGAGAATGATGGATAAG
TTCATGTAGGAATTGCTCAGTCCTTCCTTGATAAATAGATGCCCTCTTTTTTTACATTTTTTGTCTAGTTTTTGTTCTTTGAGGGTTTAG
TTTGGACAGAAAGGTGAAATTCAGATGACTTGCCTTGAAAGCTCAAGTAGTTTATGTAATTTCTCTATTTTGCTGATGTTAATGAAAATT
TAGCTTGGAAATTAAAAAAAAAAAAAGTATACATTTCAGTTTATCATATTTGATGCT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
Solyc02g082700	Solyc02g082700

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	4
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	2
Solanum lycopersicum	LeMiToFr02	fruit	18697	1
Solanum lycopersicum	LeMiToLf01	leaf	30679	8
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	3
Solanum lycopersicum	LeWCAD	Seedling Two-week-old seedings	227	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	17
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	vSlycmRNA		8362	2
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	3
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (64)

Alignment image suppressed for unigene with 64 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (3)

Annotations (manual: 2 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U314981	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: