Sol Genomics Network

Unigene SGN-U272218

Unigene Basic Information

Unigene ID:	SGN-U272218
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	272218
mRNA sequence:	Length: 661 bp

>SGN-U272218 Solanum tuberosum #4 (11 members)
CAACTCTCATCCTCCTTGAAGAAAATCGAAGCTGCGGGCGGCTACGTGTTCTTCTTCTTCATCAAATCGAAAGTATGGCGTATGCAGCAA
TGAAGCCGACAAAACCAGGGCTGGAGGAGCCCCAGGAGCAGGTTCACAAGATTAGGATCACTCTTTCTTCCAAAAACGTTAAGAATCTTG
AGAAAGTGTGTGCGGATTTGGTCCGTGGTGCTAAGGACAAGAGGCTCAAGGTAAAGGGACCTGTGCGAATGCCCACAAAGGTTCTTAACA
TTACCACTAGGAAGTCTCCCTGTGGAGAAGGCACTAATACGTGGGACAGGTTTGAGCTGCGGGTTCACAAGCGTGTGATTGACCTTTTTA
GCTCCCCAGATGTTGTCAAACAGATCACCTCAATCACTATCGAACCTGGTGTTGAGGTTGAGGTCACCATTGCTGATTCTTAGAATCTTA
ATTGTTTTCATTAGGTTGTTGAATTACCCGTTTATCTGTTTAAGTACATTAGTTGTTTGGAATTTCTTTTGTGGTCATCTTAATTTTGGG
GTTAATGTTTGCAGACGAAGTGTATTAGAGGTTTTCTTTTGTTCCAACTACAGTTTTGCAGTTAAAAGCAGATACTATTTGATATTCAGA
AGAGAATGTGCGTTGGTTAACAAAAAAAAAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (9)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDA	Tubers	5977	1
Solanum tuberosum	ACDC	Sprouting Tubers	5177	1
Solanum tuberosum	CSCH	Tubers	5038	1
Solanum tuberosum	MXFL	Floral buds	6603	1
Solanum tuberosum	MXLF	Leaves	6585	1
Solanum tuberosum	PPC	leaf 6 week old	5062	1
Solanum tuberosum	SLMW	Assorted Stolon/Tuber Developmental Series	1368	1
Solanum tuberosum	SWST	Stolon	5942	3
Solanum tuberosum	TUBS	Tubers	5976	1

mRNA member sequences (11)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	968	Ribosomal_S10 Ribosomal_S10_b Ribosomal_S10e/a	19
2	23603	Ribosomal_S10 Ribosomal_S10_b Ribosomal_S10e/a	11
5	57679	Ribosomal_S10 Ribosomal_S10_b Ribosomal_S10e/a	11
1.1	102313	Ribosomal protein S10 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	17
2	120448	Ribosomal protein S10 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S10 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	9
5	130735	Ribosomal protein S10 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S10 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	9

Preceding Unigenes (1)

Unigene	Build
SGN-U250472	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: