Sol Genomics Network

Unigene SGN-U275016

Unigene Basic Information

Unigene ID:	SGN-U275016
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	275016
mRNA sequence:	Length: 718 bp

>SGN-U275016 Solanum tuberosum #4 (6 members)
TCTTGCTATTTTCCTCTCCCTTGCAAGAAAACACCCATAACCATTTTCAAAGAGTTATTGAAAGAATCCATGGCAGGAGGATCAGAAGTG
GTTGAAGCTGCTTTATCTTGTGCTAAATGTAGCAAGCCTGCTCATCTTCAGTGTCCTAAGTGCGTGGAGTTAAAGCTCCCTCGTGAAGGT
GCTGCTTTCTGCACGCAGGATTGTTTCAAGGCATCTTGGAGTTCTCACAAGTCTGTCCACTTGAAGGCAAAATTATCGTCTCTGGCAACT
GAAACTCCAGGTGAACAAAATGCAGCCTCACCTAGTGATGGTTGGCTATATTGCTTGAGGAAAGGACAGGCTCGAACACCAAAAATTCCG
TATTTTGACTGGACTGGGACGCTGAGGCCCTATCCAATATCAGAAAAGCGTGTTGTACCTGCTCACATTGATCTACCTGATTGGGCAAAT
GATGGTATCCCAAAAATTGAACCCAGTAGTGATTTGCAGCATGTTGTTGAGATCAAAACTCCAGAGCTGATTGAGAGAATGAGAGAAACT
TGCCGAATAGGAAGGGAGGTTTTGGATGCAGCTGCTCGTATTATTAGACCTGGCGTGACTACTGATGAAATTGATGCAGTGGTCCATGAG
GTTACTGTTGCTGCTGGTGGATATCCGTCTCCCCTAAATTATCATTTTTTCCCCAAGTCATGCTGCACGTCGGTCACTGAAGTGATCT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (5)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	CSWB	Tubers	6124	1
Solanum tuberosum	PPI	leaf 6-week old leaf	5434	1
Solanum tuberosum	SWST	Stolon	5942	2
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	1
Solanum tuberosum	cSTD	dormant tuber one month post harvest	5045	1

mRNA member sequences (6)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1280	Pept_M24_MAP Pept_M24A_MAP1 Pept_M24A_MAP2	15
2	23186	Pept_M24_MAP Pept_M24A_MAP1 Pept_M24A_MAP2	15
5	60169	Znf_MYND Pept_M24_MAP Pept_M24A_MAP1 Peptidase_M24 Znf_CCHC Znf_HIT Pept_M24A_MAP2	5
1.1	102056	Peptidase M24 - Biological Process: proteolysis (GO:0006508) - Molecular Function: metalloexopeptidase activity (GO:0008235)	23
2	119545	Peptidase M24 methionine aminopeptidase - Molecular Function: methionyl aminopeptidase activity (GO:0004239) - Biological Process: proteolysis (GO:0006508) Peptidase M24 - Biological Process: proteolysis (GO:0006508) - Molecular Function: metalloexopeptidase activity (GO:0008235) Peptidase M24A methionine aminopeptidase subfamily 1 - Molecular Function: methionyl aminopeptidase activity (GO:0004239) - Biological Process: proteolysis (GO:0006508)	14
5	132574	Peptidase M24 methionine aminopeptidase - Molecular Function: methionyl aminopeptidase activity (GO:0004239) - Biological Process: proteolysis (GO:0006508) Peptidase M24 - Biological Process: proteolysis (GO:0006508) - Molecular Function: metalloexopeptidase activity (GO:0008235) Peptidase M24A methionine aminopeptidase subfamily 1 - Molecular Function: methionyl aminopeptidase activity (GO:0004239) - Biological Process: proteolysis (GO:0006508)	5

Preceding Unigenes (1)

Unigene	Build
SGN-U246290	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: