Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577971 in the current build, Tomato 200607 #2

Unigene SGN-U312377

Unigene Basic Information

Unigene ID:	SGN-U312377
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312377
mRNA sequence:	Length: 2160 bp

>SGN-U312377 Tomato 200607 #1 (103 members)
TAGGACGTATAATTATGTAGGTATCTACTTATTCAACTTGGTGAATAGTTTAAGCACGTACTTGCTTGTGTATATTCAAAATTGAATGAC
ATAGACGCGGTTAAAGAGTAGAGAATGAGTAAAACGTGTTGACATGCAAATATCTTGTTCTTTCTTCCATATAAGTGATGCAGAGAAAGA
CTTAAGTATACACAACAAATTTTCTTTATTTACAATGGCAACACTAAGAGTTTCTTCATTGTTTGCTTCTTCTTCTTCATCTTTGCATTC
TAACCCTTCAGTTTTTACTAAATATCAATCTAGTCCCAAATGGGCTTTTTCATTTCCAGTTACACCCTTGTGTTCAAAAAGAAGTAAAAG
AATAGTTCATTGCATTGCTGGTGATACTCTTGGTCTTACTAGGCCTAATGAAAGTGATGCCCCTAAGATATCAATTGGTGCTAAAGATAC
TGCTGTGGTGCAATGGCAAGGAGACTTACTTGCAATAGGCGCGACGGAGAATGACATGGCTAGAGATGAGAATTCTAAGTTCAAGAATCC
ACTATTGCAACAGCTTGATTCCGAATTGAATGGTTTATTGTCTGCAGCTTCTTCTGAGGAGGATTTTAGCGGAAAGTCTGGACAATCCGT
AAATCTCAGGTTTCCTGGTGGAAGGATTACTCTAGTTGGTCTTGGCTCATCAGCATCATCACCTACTTCTTATCACAGTTTAGGACAGGC
TGCTGCTGCTGCTGCCAAGTCTTCTCAGGCTCGTAATATTGCCGTTGCACTTGCTTCCACCGATGGACTCTCTGCAGAATCGAAGATTAA
CTCTGCCTCTGCCATAGCAACTGGAGTTGTGCTAGGGTCATTTGAAGATAATAGGTTTAGGTCCGAGTCGAAGAAATCAACTTTGGAATC
TTTGGATATTCTTGGACTGGGAACTGGACCTGAAATAGAGAGGAAAATCAAGTATGCAGAACATGTATGTGCAGGTGTTATACTCGGTAG
AGAGCTCGTTAACGCACCAGCCAATATAGTTACGCCTGCGGTACTTGCTGAAGAGGCTAAAAAGATTGCGTCCACTTATAGCGATGTCAT
TTCTGTTAACATTTTGGATGCTGAGCAGTGCAAAGAATTGAAAATGGGAGCCTACTTAGCTGTTGCTGCAGCAGCTACTGAAAATCCTCC
TTACTTCATCCATTTATGTTTTAAAACTCCTACTAAGGAACGCAAAACAAAGTTAGCCTTGGTTGGAAAGGGATTAACTTTTGACAGTGG
TGGCTACAACCTCAAGGTCGGAGCTGGTTCGAGGATTGAGCTAATGAAGAATGACATGGGAGGGGCTGCTGCTGTTTTAGGTGCAGCAAA
AGCTCTTGGTGAAATTAGGCCTTCCAGAGTAGAGGTGCATTTCATTGTCGCAGCATGTGAAAATATGATCAGTGCAGAAGGCATGAGGCC
TGGAGACATTGTCACAGCTTCAAATGGTAAGACAATTGAGGTTAACAATACTGATGCTGAGGGTAGGCTCACACTTGCTGATGCTTTGAT
ATATGCCTGTAACCAAGGTGTTGAGAAGATAATTGATCTGGCAACATTAACTGGTGCTATTATGGTTGCTCTTGGACCTTCAGTTGCTGG
TGCTTTTACACCTAATGATGACCTAGCAAGGGAGGTTGTTGAAGCTGCTGAGGCAAGTGGTGAAAAACTATGGAGGATGCCTATGGAGGA
GAGTTACTGGGAGAGTATGAAATCAGGAGTGGCTGATATGATTAACACGGGGCCTGGTAATGGCGGTGCTATAACTGGTGCTCTCTTCCT
CAAACAATTTGTTGACGAGAAGGTTCAGTGGTTGCATCTCGATGTAGCTGGCCCCGTATGGAGCGATGAAAAGAAAAACGCCACGGGTTA
TGGTGTTTCAACTCTGGTGGAATGGGTGCTGAGGAACTAGTCAAGATGTTGATGGCTAAACATATTAGGGACTAATGATGTTTGGAAAAA
TAAATGCATCAAGTTGTATGAATAAAGGCAATAGTATAGGCTTTCTTGTTATCTTGATTAATAAAATGCCTAAATAAAATTGCCACTTTA
CCTTTTGAAATGAAATTTATTATTCCCGTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCGAGCTAGTTTCT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
lap2	leucine aminopeptidase 2

Genomic locations (0)

None

Library representation (11)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	9
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	35
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	4
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	7
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	38
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	vSlycmRNA		8362	3
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (103)

Alignment image suppressed for unigene with 103 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101635	Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Lg106-like Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508)	54
2	118642	Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	40
5	129107	Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	40

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U212650	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: