Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577765 in the current build, Tomato 200607 #2

Unigene SGN-U312774

Unigene Basic Information

Unigene ID:	SGN-U312774
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312774
mRNA sequence:	Length: 754 bp

>SGN-U312774 Tomato 200607 #1 (41 members)
ATTTAGGCACACTCATCGTGCTCTCCGCCACTTCTCAATTTGCATTATTTCAGATCTATTCCTCTTTTTCTTCGTTTCCTCTGCATCCAT
CAATGGCTTCCATTACAGGCTCATCAGCTACCGCCATGTCCTGCTCCTTCAAGGCACCTAACCGTGTATCGAATTTGAAAACATCTTCTC
TTTCATTCAAGGGGATTAGCTACTCTTCCATCAGTGTGAATCCAGCCACTCGTCGCCTCAGTATTACTTGTGCGGCTAAGCCAGAGACTG
TCAACAAAGTGTGTGACATTGTGAAGAAACAACTGGCTCTTTCTGCTGATACTGATGTCTGTGGAGATTCAAAGTTTGCTGCGCTTGGTG
CTGATTCTCTTGATACGGTGGAGATTGTCATGGGACTTGAGGAAGAATTTGGCATCTCGGTGGAAGAAGACAGTGCTCAGAGTATTGCAA
CCGTTCAAGATGCTGCAGACCTGATTGAGGATCTCATTTCAAAGAAAGCTTGAGACTGAACTGAACTTTATTTAGAACCTCAGCTAGTTT
GCTTATTAGGATTATCTCGTTTGGTTGTGTTTTACAGTTGAAGATGATGCAGTTTGCAATATTAAACTTTTGTCTAATTAAAGAACTCTG
TTTCATCAGAGAGGAAGCCTCGTGAGCTGTCTTGTTTTCGCCGAATCCTGCAATGAAATCTAAAGATATATCTATTCCTTTATGCTAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (18)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	4
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	6
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTSB	seed	1880	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	12

mRNA member sequences (41)

Alignment image suppressed for unigene with 41 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101737	Phosphopantetheine-binding - Molecular Function: cofactor binding (GO:0048037) Acyl carrier protein-like Acyl carrier protein (ACP) - Molecular Function: acyl carrier activity (GO:0000036) - Biological Process: fatty acid biosynthesis (GO:0006633)	42
2	118997	Phosphopantetheine-binding - Molecular Function: cofactor binding (GO:0048037) Acyl carrier protein-like Phosphopantetheine attachment site - Molecular Function: phosphopantetheine binding (GO:0031177) Acyl carrier protein (ACP) - Molecular Function: acyl carrier activity (GO:0000036) - Biological Process: fatty acid biosynthesis (GO:0006633)	23
5	129405	Phosphopantetheine-binding - Molecular Function: cofactor binding (GO:0048037) Acyl carrier protein-like Phosphopantetheine attachment site - Molecular Function: phosphopantetheine binding (GO:0031177) Acyl carrier protein (ACP) - Molecular Function: acyl carrier activity (GO:0000036) - Biological Process: fatty acid biosynthesis (GO:0006633)	22

Preceding Unigenes (1)

Unigene	Build
SGN-U213720	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: