Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578708 and SGN-U581008 in the current build, Tomato 200607 #2

Unigene SGN-U312929

Unigene Basic Information

Unigene ID:	SGN-U312929
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312929
mRNA sequence:	Length: 791 bp

>SGN-U312929 Tomato 200607 #1 (80 members)
AACAACAGGTGTAGTGGGAGCAGTAACTGGAGCGGTTACTGGAGCAACAGGAACAGCTGTAGGTGGGGGCGATTGGCGGTCAATCGGCCG
AATTGACACTTCACAGAGTAGTATAGTAAGCTAAGAGAGAGAAAATGGTGTTGATTGATAAACTTTGGGATGATGTTATGGCTGGTCCCA
GCCCTGATAAAGGACTCGGCAAACTCAGAAAGAGCCTCACTATTCAAACTGGTGGTGAATCAGGAGAAGGATCTAGCAAGTACCAGAGAT
CTCTGTCGATGCCGGCAAGTCCGCCGACGCCAGGTACGCCGGTGACGCCGACGAATATATCGCCGACGGTACGGAAAGAGAATGTGTGGA
GGAGTGTTTTTCACCCAGGGAGCAATTTAGCTACCAGGAGAATTGGTGCTGAAGTGTTTGATAAGCCTTCTCACCCTAACGCTCCTACTG
TTTATGACTGGCTCTACAGTGGGAACACCAGATCTAAGCATCATGAGAAGTGCTGAGAGTTTTTGGGTGGAAAAAAGCAGTAGAAAATCT
TCATGTAAATAGTGTTTTTTTTCCTATGCGAGTTGGGGACTTGCTATCTATATTTGTGATTATATGTTTTTTCTGTTGGGTATTAAGTTA
TAATTAAGTAGTATGCTGTATTGTAAATTACGCTTTCAAAAGCTAATTTCTTAGCTTTAATGGCAGGCCATCTATGGCTTTCTAGTTCCA
AATGAAGTTGTTACTATTATTACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (21)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	12
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	5
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	4
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	10
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	7
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	9
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	8
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum lycopersicum	cTSB	seed	1880	2

mRNA member sequences (80)

Alignment image suppressed for unigene with 80 aligned sequences.
[Show Image]

Markers Information (2)

Expression Data (5)

Annotations (manual: 1 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101872	Dormancyauxin associated	31
2	119236	Dormancyauxin associated	18
5	129654	Dormancyauxin associated	17

Preceding Unigenes (1)

Unigene	Build
SGN-U213616	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: