Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578002 in the current build, Tomato 200607 #2

Unigene SGN-U314225

Unigene Basic Information

Unigene ID:	SGN-U314225
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314225
mRNA sequence:	Length: 721 bp

>SGN-U314225 Tomato 200607 #1 (27 members)
GTCGAAGCCCAAAAGATTACTATTACTGGGCCACAAGCCCATTCCTCACTCGGTAAACACCAGCAGTCTAGGGTTTCAGTATTCTTCTCC
AGTTTACAGCTCCAGAGTCGAAAATGGTGAAGGGACGCCAAGGAGAGCGTGTAAGACTCTACACTAGAGGAACGGTCCTTGGATACAAGA
GGTCGAAGTCGAATCAGTATCCAAACACTTCATTGGTTCAGATCGAGGGAGTCAACACTAAGGAAGAAGTAGATTGGTACTTAGGGAAGC
GTATGGCTTATGTATACAAGGCGAAAACTAAGAAGAACAACTCGCATTATCGTTGTATTTGGGGTAAAGTTTGTAGGCCTCATGGTAACA
GTGGAGTTGTTAGAGCTAAATTCAAGTCCAATCTGCCACCAAAATCCATGGGAGCTAAGGTTAGAGTTTTCATGTACCCAAGCAATATAT
AAAGCAAGGTATTTAGTTGATGCTTACTTGGAGGCCCTACGTTTGTCTATCGAGGTCTTTAGTGGTGAAGGTTTTGAATCTTTAAAATAT
AGTTGACATAAATTGTTTCAAGTTTTTTTGGTATTTTTGTTTGTCATGTACTCTGAAATACCATGGTTTGAACATCTAATTAGATGTCTA
ATTTTATTCTTGGATTTAAAAAAAAAAAAAAAAAAAAAAACTTATATGACTTTGACATGAACCATCTAACTTGAAAATCAAAAAAAAAAA
A

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (11)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LE15	Fruit 15 days post anthesis	269	1
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	5
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	5

mRNA member sequences (27)

Alignment image suppressed for unigene with 27 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101742	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Glutamyl-tRNA synthetase class Ic - Molecular Function: glutamate-tRNA ligase activity (GO:0004818) - Molecular Function: ATP binding (GO:0005524) - Biological Process: glutamyl-tRNA aminoacylation (GO:0006424)	41
2	118818	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28
5	129394	Ribosomal protein L35Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	22

Preceding Unigenes (1)

Unigene	Build
SGN-U214386	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: