Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U268980

Unigene Basic Information

Unigene ID:	SGN-U268980
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	268980
mRNA sequence:	Length: 832 bp

>SGN-U268980 Solanum tuberosum #4 (22 members)
AAAAAAAAAAAAAGGGGGGGGGCTCAGATCGCAAATTACTTCAATTTCCCAGTTCGAAGAAGATAAAAATGGCTTCTACGTTTAGTGGCG
ATGAAACGGCACCGTTTTTTGGCTTCCTCGGCGCTGCAGCTGCCTTAGTCTTCTCCTGTATGGGTGCAGCTTATGGTACAGCGAAGAGTG
GGGTAGGAGTAGCGTCGATGGGTGTAATGAGGCCGGAATTGGTAATGAAGTCAATTGTTCCGGTTGTTATGGCTGGAGTTTTGGGTATTT
ATGGGTTAATTATTGCTGTGATTATTAGTACTGGGATTAACCCGAAAACTAAGTCGTATTATCTATTTGATGGATATGCTCACCTTTCAT
CTGGTCTTGCTTGTGGTCTTGCTGGTCTTTCTGCTGGTATGGCTATCGGAATCGTTGGTGATGCTGGTGTTAGAGCTAATGCACAGCAGC
CAAAGCTTTTTGTTGGAATGATTCTGATCCTTATTTTTGCTGAAGCCTTGGCTCTTTACGGCCTTATTGTCGGTATCATCCTTTCTTCTC
GCGCTGGTCAATCTAGAGCAGAGTAGAGAAAAAGTGTCACCTGTTCCATAATTGTGAAGTATCTTTGTGTTCTTCCTCGTTCGATGAGCT
AGTTTGGCTGTTGAATTACATTTTGTTTAGTTTTGGCCTCCGTGATTATGTATTTGATTGCTTGGCTAGAAGAATTCCCTCAATAAAGAT
ATCAAACTTTTCCGATATTTTTGAAAGACAATAATTGGATTGCTGTAAAATGTTCCCTGTATTAATTTATATTGACTTTACTTTTAAGCT
TTAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (10)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDC	Sprouting Tubers	5177	1
Solanum tuberosum	CSWB	Tubers	6124	4
Solanum tuberosum	IVROOT	Root	5850	3
Solanum tuberosum	MXFL	Floral buds	6603	1
Solanum tuberosum	PPC	leaf 6 week old	5062	1
Solanum tuberosum	PPI	leaf 6-week old leaf	5434	1
Solanum tuberosum	STOL	Stolon	6462	2
Solanum tuberosum	TUBS	Tubers	5976	3
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	4
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	2

mRNA member sequences (22)

Alignment image suppressed for unigene with 22 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	317	ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	51
2	22204	ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	46
5	56510	YidE_YbjL ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	35
1.1	101725	ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	43
2	118618	ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	43
5	129191	ATPase V0 complex proteolipid subunit C eukaryotic - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	32

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U243837	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: