Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579097 in the current build, Tomato 200607 #2

Unigene SGN-U312578

Unigene Basic Information

Unigene ID:	SGN-U312578
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312578
mRNA sequence:	Length: 1019 bp

>SGN-U312578 Tomato 200607 #1 (44 members)
GGGCACAGAAAAGCTCTATCAACCCTATTCTCTTCTCACTTTTACAATATCAAGAGATGGGTGAGGTAGTTAAGGGAGCTGTTCCAGTTC
CAGAGTCAGTATTGAAGAAGCAAAAAAGGAGCGAGGAATGGGCCCTTGCAAAGACACAAGAGCTTGTAGCTGCAAAGAAGAAAAGTGCTG
AGAACCGGAAATTGATCTACAACAGAGCTAAGCAGTATGCTAAGGAGTACGACCAGCAGGAAAAGGAGTTGATCCGTTTGAAGCGTGAGG
CTAGATTGAAGGGTGGTTTCTATGTTGACCCTGAAGCTAAGCTGTTGTTTATCACTAGAATCCGTGGGATTAACGCTATGCCTCCACAGA
CCAAAAAGATATTGCAGCTTCTACGGTTGAGACAGATCTTTAATGGTGTCTTTTTGAAAGTCAACAAAGCCACTGTCAACATGCTTCACA
GGGTTGAACCTTATGTTACCTATGGTTACCCTAACCTAAAAAGTATTAGAGAATTGATCTACAAGAGAGGTTATGGGAAAGTTGACAAGC
AGAGAATTGCTTTGACTGACAACGCTGTCATTGAGCAGGTATTGGGTAAGTATGGAATTATCTGCATGGAAGACCTAGTCCATGAGATCA
TGACTGTTGGACCCCATTTCAAGCAGGCCAACAACTTCCTATGGCCGTTCCAACTCAAGGCACCTTTGGGTGGACTGAAGAAGAAAAGGA
ATCACTATGTTGAAGGAGGTGATGCTGGTAACCGTGAGAACTTTATCAATGAACTTATTAGGAGGATGAACTAAGAGAGTTGGAAATTTT
GCTATATTAGGATTGAGAACTTTATCTCAACTTTTTCAGACCCTTTTGGGTTATTGAAGTGATAAACAGCTTCAGATTTTCTGCCTTCAT
TTTGAGATTGTTTAGAGTTATGACAGTATACGACAATGATGATGTTTTTTTCCGCAGGGAACATATCTAATGTCAAATTATTATCTTTAT
CCATAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (18)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	2
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	6
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	9
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	3
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	3
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	4

mRNA member sequences (44)

Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101435	NAD-dependent epimerase/dehydratase - Molecular Function: catalytic activity (GO:0003824) - Biological Process: nucleotide-sugar metabolism (GO:0009225) - Molecular Function: NAD binding (GO:0051287)	166
2	118460	NAD-dependent epimerase/dehydratase - Molecular Function: catalytic activity (GO:0003824) - Biological Process: nucleotide-sugar metabolism (GO:0009225) - Molecular Function: NAD binding (GO:0051287)	116
5	129264	Ribosomal protein L30 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal L30 N-terminal Ribosomal protein L7 eukaryotic form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934) - Molecular Function: transcription regulator activity (GO:0030528)	28

Preceding Unigenes (1)

Unigene	Build
SGN-U213500	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: