Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580070 in the current build, Tomato 200607 #2

Unigene SGN-U312741

Unigene Basic Information

Unigene ID:	SGN-U312741
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312741
mRNA sequence:	Length: 1158 bp

>SGN-U312741 Tomato 200607 #1 (31 members)
CTAATCGCAAATAGAGGCCAAGTGTATTTGAACACTTCATCGTCTTCACGGCCTCCAACCGAAGATGAAGTTCAACATTGCGAATCCCAC
CACTGGGTGCCAGAAAAAGCTTGAAATCGATGATGATCAGAAACTCCGAGCTTTCTTTGACAAAAGGATCTCCCAGGAAGTTAGCGGAGA
TTCTTTGGGTGAGGAGTTCAAGGGTTACGTTTTCAAGATAATGGGAGGATGTGACAAGCAAGGGTTCCCTATGAAACAGGGAGTGTTAAC
TCCTGGCCGTGTTCGCCTTTTGCTCCACAGAGGTACTCCTTGCTTCCGTGGTTATGGTAGGCGAAATGGAGAGCGCAGAAGGAAGTCTGT
CCGTGGATGCATTGTCAGCCCTGATCTTTCTGTTTTGAACCTGGTTATTGTTAAGAAGGGGGAGAATGATCTGCCTGGACTGACCGACAC
TGAAAAGCCAAGGATGAGAGGACCCAAAAGGGCTTCCAAGATCAGAAAGCTCTTCAATCTTTCCAAGGAAGATGATGTCAGGAAGTATGT
CAACACTTACCGCAGAAATTTCACCACCAAAACTGGTAAAAATGCAAGCAAAGCTCCTAAGATTCAGAGGTTAGTGACACCCCTGACATT
ACAAAGAAAGAGAGCGAGAATTGCTGACAAGAAGAAGAGAATTGCCAAGGCTAAGTCAGAGGCAGCTGATTATCAGAAGCTTCTTGCTAG
TAGGTTGAAGGAACAAAGAGAACGACGTAGTGAGAGTTTGGCTAAGAAGAGGTCTAGACTCTCTGCAGCATCTAAGCCATCTATTGCCGC
TTAACTTCAGTGGGGAGGAAAAATGACGATGAGTAGGATCTAGTTCCTGCTATTTTTTTGGTCTGATTCTTATAGTTGTTTCTGGATGTC
TTACTCAGTATTTCTCATTTCTAGTTTTCTCAGGCAATACTTTGGTCTGATAGAGTTGCCACATACAATTAATTATCTTTCATGTTCCAG
ATTTTGGTTACTTTGTCCCTATATACAAGGATCAGCTGTTTTATGTTTTTCTTGAAGTTTCTTTTTGTTTACTTATCTGACATTAATGTA
TTTTCATCTGTCTTCTAAACTATACTGAGGTTGACGACCTTACAATTTCGAAACTGTCATCTGAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (18)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	2
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (31)

Alignment image suppressed for unigene with 31 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102411	Ribosomal protein S6e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	15
2	119625	Ribosomal protein S6e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	14
5	129949	Ribosomal protein S6e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	14

Preceding Unigenes (1)

Unigene	Build
SGN-U213057	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: