Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U568728 and SGN-U579745 in the current build, Tomato 200607 #2

Unigene SGN-U312871

Unigene Basic Information

Unigene ID:	SGN-U312871
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312871
mRNA sequence:	Length: 1006 bp

>SGN-U312871 Tomato 200607 #1 (143 members)
GACCACAAACATTACCCTATAATTCCCAAACATTTGTAATCAAGTCTTACCTGAAACATTTTATTTTATCACCAAAACAAAAAGGTCCTG
AGGAATGGCTCATGCTATGGCTTCTATGGGTGGCCTAATTGGTTCTTCACAAACTGTCTTGGATGGTAGCCTCCAGCTTAGTGGCTCAGC
CCGCTTGAGTACTGTTAGCACCAACAGAATTGCCTTGTCTAGACCAGGACTCACTGTCAGAGCCCAACAGGGGTCTGTTGACATCGAAAC
TAGCCGTAGAGCCATGATTGGTCTTGTTGCTGCTGGCCTAGCTGGTTCCGTTGCTAAAGCAGCTTTTGCTGAAGCCAGGTCAATTAAGGT
TGGCCCCCCACCTCCTCCCTCGGGTGGATTGCCTGGAACTTTGAACTCAGATGAGGCAAGGGACTTCAGTTTGCCATTGAAGAATAGGTT
TTACCTTCAACCGTTGACTCCAGCTGAGGCAGCCCAGAGAGTTAAGGATTCAGCCAAGGAGATTGTTAGTGTCAAGGATTTCATCGACAA
GAAGGCCTGGCCTTACGTCCAGAATGACCTTCGTCTCAGAGCAGAATACCTTCGCTATGACCTTAAGACTGTTATCTCTGCTATGCCAAA
AGAACAGAAGGGAAAACTCCAGGATCTGTCTGGAAAGCTCTTTAAGACCATTAGTGATCTGGACCATGCAGCTAAGACCAAGAACAGTGC
TGAAGCACAGAAGTACTATGCTGAAACTGTAACTACCTTAAATGATGTTTTGGCCAACCTGGGCTAGAAAATTTTTCTCTACTATGTTAT
TACTTCCTGTAAGTTAACGAATACTTCTTGAATCAATTGTGAAGAATGATTTTGGAAGAAAAAAATAAAAAAAAAAAAAAAAAAAAAAAA
ATCCGAGAGCCTCAACTTGAGTTCTGCATGTGATTTTGATTGGGAATTTCACTTGATTGAGGCCTGCAAATGATAAACATGGTTGCACCA
TTCCAGAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
psbq	photosystem II oxygen-evolving complex protein 3

Genomic locations (0)

None

Library representation (23)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LA	Leaf Mature leaves	6589	8
Solanum lycopersicum	LB	Leaf Mature leaves	3316	14
Solanum lycopersicum	LC	Leaf Mature leaves	5712	16
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	3
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	5
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	15
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	19
Solanum lycopersicum	cLES	leaf 4 weeks	5243	5
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	21
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	17
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	cTSC	seed	2256	2
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (143)

Alignment image suppressed for unigene with 143 aligned sequences.
[Show Image]

Markers Information (1)

Expression Data (3)

Annotations (manual: 3 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102018	Photosystem II oxygen evolving complex protein PsbQ - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898)	24
2	120464	Photosystem II oxygen evolving complex protein PsbQ - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898)	9
5	130751	Photosystem II oxygen evolving complex protein PsbQ - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898)	9

Preceding Unigenes (1)

Unigene	Build
SGN-U213262	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: