Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U586311 in the current build, Tomato 200607 #2

Unigene SGN-U313413

Unigene Basic Information

Unigene ID:	SGN-U313413
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313413
mRNA sequence:	Length: 1194 bp

>SGN-U313413 Tomato 200607 #1 (76 members)
ATCGGCCGAATTGACACTTTTTGCAAGCGTAAGAATAGTCACTCAAAAAAGCACCCATCAACCAAAAAAAATCCCCAATAGCCGGCGGCG
CACGTTAGTGAGATCGGAGTAAACGATGGCCGATCACGCCGGCGAGCACGAACCAGTCGTTGAATCCGTCATGGAAAAGATCAACGAAAA
GTTGCACGACCACAATTCTTCCTCATCCGATTCTGAAGATGAGAAGGAGAAAATATCGTCGGTCGATGCCGTCAAGGCAAAGATCTATCG
TCTCTTTGGCAGGGAAAGGCCCGTCCATAAGGTTCTCGGCGGTGGAAAACCTGCGGACATTTTTCTGTGGAGGGACAAGAAAATTACTGC
CGGTGTGCTTGGGTTTGCCACTTCACTTTGGGTGCTTTTTGAGTTGCTTCAGTACCATTTGCTTACACTTGTTTGCCATATACTGATCCT
TGCATTGGCAGTCCTTTTCCTTTGGTCCAATGCATCTACCTTCATCAACAAGTCTCCACCCCAAATTCCAGATGTCATTCTGCCTGAGGA
TATTGTCCTGGGTGTTGCTGCTGCACTCAGGATTGAAATAAACAGAGCTCTTGAAGTTTTTCGGGATATTGCCTCTGGGAAAGAGTTGAA
GAAATTCCTCGGTGTTATTGCTGGTTTGTGGGTTCTTTCAATATTGGGCAACTGCTGGAACTTCCTCACTCTGTTTTACATATGCTTTGT
ATTGCTCCATACCGTCCCTGTACTTTATGAGAAATTTGAGGACCAGGTTGATGCTTTTGCTGAGAAGGCTGAGGCAGAGATCAAAAAGCA
GTATGCTGTTTTCAACGTCAAGGTTCTAAGCAAAATTCCAAGAGGTCCACTGAAAGACAAAAAGTTGTTATAGACATGAATAGGTGGCAC
CTTTAGGTTCACGGAGGCGTTCCTCTGGTTGTTGTGAATCAGTTATGGTAGAAAACCCTTTGCTTACTTGTTTTGCTTGATTATTACTAA
ACAGGCTTGGCGTTTTTGTGATAGATTTGAGTTTCCGGATATGGTTTACTTTTTTGTTAAATTTTGAAAGACTGCTGAAAGATTATGGCA
GTCATCATGTGACTGTAAAACATCAATATGCAAGTGAGTGTTACTTTAAATTACAAGTCAGATAATGGAAACACAACTTTGATTCTTATA
AAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (28)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	6
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	13
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	5
Solanum lycopersicum	LA	Leaf Mature leaves	6589	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	2
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	7
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	4
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	7
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	3

mRNA member sequences (76)

Alignment image suppressed for unigene with 76 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 0 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101613	Reticulon - Molecular Function: molecular function unknown (GO:0005554) - Cellular Component: endoplasmic reticulum (GO:0005783)	59
2	118554	Reticulon - Molecular Function: molecular function unknown (GO:0005554) - Cellular Component: endoplasmic reticulum (GO:0005783)	56
5	129043	Reticulon - Molecular Function: molecular function unknown (GO:0005554) - Cellular Component: endoplasmic reticulum (GO:0005783)	54

Preceding Unigenes (1)

Unigene	Build
SGN-U213550	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: