Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U564480 in the current build, Tomato 200607 #2

Unigene SGN-U315208

Unigene Basic Information

Unigene ID:	SGN-U315208
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	315208
mRNA sequence:	Length: 1597 bp

>SGN-U315208 Tomato 200607 #1 (44 members)
AAAATCCAAAACCCTAAGCTCTTCACCACATCAAGTTTCTGTCCATTTCCCAATTTCTCAGTTATGCCACCAAAAGCAGCTAAAGGTAAA
GAAGTTCCTGCCGAAAGGCCGATTCTTGGCCGTTTCTCATCCCACTTGAAAATTGGAATCGTAGGATTACCCAATGTGGGGAAGTCTACT
CTCTTCAACACACTGACAAAGTTATCCATTCCGGCAGAAAACTTTCCTTTTTGTACTATTGAGCCTAATGAAGCTCGAGTGCACGTTCCT
GATGAGCGTTTTGAATGGCTCTGTCAACTTTACAAGCCCAAGAGTGAGGTGGCTGCCTTTTTGGAAATTCATGACATAGCTGGACTTGTT
CGAGGTGCTCATGCAGGACAAGGATTGGGGAACAGTTTCTTATCCCACATCCGCGCAGTTGACGGCATTTTCCATGTTCTACGCGCATTT
GAAGATCCAGATATTATCCATGTTGATGACACTGTTGATCCTGTGAGAGACTTAGAGGTTATAAGTGAGGAACTAAGGCTTAAGGACATC
GAGTTCATGGAGAGAAGGATAGAAGATCTTGATAAGAGTATGAAGAGAAGCAATGACAAACAATTGAAAATAGAGCATGAATTATGTCTA
AGGGTCAAAGCATCACTCCAGGAAGGCAAAGATGTTCGTCTGGGGGACTGGAAAGCTGCAGATGTTGAATTCTTGAATACCTTCCAGCTC
CTTACTGCAAAACCAATTGTTTACTTGGTTAATATGAATGAGAAAGACTATCAAAGGAAAAAGAACAAGTTTCTGCCGAAGATTCATGCA
TGGGTGCAGGAGCACGGTGGTGAAATAATTATTCCTTTCAGTGCTGCTGTGGAGAGAAACCTTGCTGATATGCCACCAGATGAAGCAGCA
AAATACTGTGAAGAGAACAAGTTACAAAGTTGCCTCCCAAAGATCATTAAGACTGGATTTGCAGCCATTAATCTTATTTATTTCTTCACA
GCAGGGCCAGATGAGGTTAAATGCTGGCAAATCCGCAGGCTGATGAAGGCTCCTCAAGCTGCTGGAACAATTCATACAGATTTTGAGAGA
GGGTTCATCTGTGCTGAGGTGATGAAATTTGAAGATCTAAAGGAACTTGGTAGTGAATCGGCTGTTAAGGCTGCTGGGAAGTATAAGCAG
GAGGGTAAGACCTATGTGGTCCAAGATGGTGATATTATATTCTTCAAGTTCAATGTCTCTGGGGGTGGGAAGAAGTGAGGTGGTGGTGGA
TCTGCACGGAACTTATGAAGCTGCATCAATTCGTTGGCGAGTTAAAAGATGATATAGTTTTGCCTCATTATTAGGTTGCAGATAAAGTTT
ATCTTGTATGCGAGGTTTCTGCAAAATTTATGACATGTTTCATAGTCTTTATCTGCATTTGTAGCTTGATGGATATTCGAGTCATTTTTG
TCTTCTGTTTTTGTACTCCTTTCAGTGAGGCTGATGCCAAATTCAATTTATAAGTTATTGGCTGGCATTAGCATTTGATGTTATGTAGTA
ATTGAAGAAACAATCTGGAGAATTGCTGATAAAAAAAAAAAACCAAAAAAAACTCAGACTAGTTCTC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (19)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	4
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	7
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	2

mRNA member sequences (44)

Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101764	GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) GTP1/OBG - Molecular Function: GTP binding (GO:0005525)	39
2	120327	GTP1/OBG - Molecular Function: GTP binding (GO:0005525) Conserved hypothetical protein 92 - Molecular Function: GTP binding (GO:0005525) - Molecular Function: molecular function unknown (GO:0005554) TGS-like Protein of unknown function DUF933 GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622)	9
5	132325	GTP1/OBG - Molecular Function: GTP binding (GO:0005525) Conserved hypothetical protein 92 - Molecular Function: GTP binding (GO:0005525) - Molecular Function: molecular function unknown (GO:0005554) TGS-like Protein of unknown function DUF933 GTP-binding protein HSR1-related - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622)	5

Preceding Unigenes (1)

Unigene	Build
SGN-U214195	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: