Sol Genomics Network

Unigene SGN-U578218

Unigene Basic Information

Unigene ID:	SGN-U578218
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 1000 bp

>SGN-U578218 Tomato 200607 #2 (195 members)
TAGGGCGATTGGCGGCCAAATCGGCCGAATTGCTCTTCTTCCATTTCTTTCAAAATTAAAGTATTGTTACTCTGCTATTGGCTCAAAACC
TCTGCAATCTCCGTCTCCTTCAATTTCAACTCAAGCAAATCCACCTCTTTCACTAGTTTCATCACTTTCAGATCAGGGTTTGGAGTTGAA
GGTACGGGGGGCTAATTGATGGCGTCGAAGAGGATATTGAAGGAGCTCAAGGATCTGCAGAAGGATCCCCCCACATCATGCAGTGCTGGT
CCAGTGGCAGAGGATATGTTCCATTGGCAAGCAACAATCATGGGGCCTACCGATAGCCCTTATGCTGGAGGTGTATTTTTGGTTTCAATT
CATTTCCCTCCAGATTATCCTTTTAAGCCTCCAAAGGTTGCCTTCAGAACTAAGGTTTTCCATCCCAACATCAACAGCAATGGAAGTATT
TGTCTGGATATTCTTAAGGAGCAGTGGAGTCCAGCATTAACCATATCCAAGGTCCTGCTGTCCATCTGCTCTCTGTTGACAGACCCAAAC
CCAGATGATCCTCTTGTACCTGAAATTGCTCACATGTACAAGACTGACAGGGCCAAATACGAAACCACTGCTCGTAGCTGGACTCAGAAA
TATGCAATGGGATGATGCGCAAAATTGTCTCCAGGCATGTCTGGGACTTTTGTAACAGCAATGTCTTATTGTGCTTGGGGTGAATGAATA
AATTCCGTGAAAGAACTTAGTTACTTCTTAATCTCCCTTCATGAGGGTTGTTAAGGGAACAGCTGTTTTCAATTTGTGAATATTTATTTG
ATGACTAGTAAGGGAGAAACTGCAATGTAATTCTACTTTGTTTGCCAGTTTGACATGCGCCTTTCCCCAAATTTGTCTGACAAATATAGT
TTACATCTTTGAATTCTGGGATTGATTTACAAATTATCAAACACTAGTTTTTCATCATGTTCTATTGTTGAAAATGGAAATGATGACAAG
TAATTTTATT

[Blast] [AA Translation]

Associated Loci (2)

Locus symbol	Locus name	Gene activity
ubca	ubiquitin carrier
Solyc06g007510	Solyc06g007510

Genomic locations (0)

None

Library representation (37)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	4
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	16
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	22
Solanum lycopersicum	LA	Leaf Mature leaves	6589	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	1
Solanum lycopersicum	LeMiToFr02	fruit	18697	2
Solanum lycopersicum	LeMiToLf01	leaf	30679	5
Solanum lycopersicum	LePU	Pericarp Turning stage of fruit ripening.	1542	5
Solanum lycopersicum	SSH_3DPA	flower 3 days after Anthesis	252	1
Solanum lycopersicum	Sl_FruitQTL	late maturation (breaker and red ripe)	663	2
Solanum lycopersicum	Sl_RootGC01		128	1
Solanum lycopersicum	Sl_RootInf01	root and collar Three weeks old	385	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	3
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	20
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	13
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	13
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	7
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	2
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	4
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	8
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	3
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	5
Solanum lycopersicum	cTOS	suspension cultures	8026	11
Solanum lycopersicum	cTSC	seed	2256	3
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum lycopersicum	vSlycmRNA		8362	18
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (195)

Alignment image suppressed for unigene with 195 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (5)

Annotations (manual: 3 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U312765	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: