Sol Genomics Network

Unigene SGN-U581590

Unigene Basic Information

Unigene ID:	SGN-U581590
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 933 bp

>SGN-U581590 Tomato 200607 #2 (168 members)
AATACATCAACATAATAATCATAAAGTAAATGAATCAGTGAATATGTTACAAGGCTAGAACTGTTTGTGGAAGGAGTATATGGAACTGAT
CATTATCAGCACTCATATTGGACTTCTCTCTCTCTCTCTCTAAGGGTGACCTGAGATCACATACAAAAATGGTGAAGGCCGTCGCCGTCC
TTAACAGCAGTGAAGGTGTTAGTGGCACCATCCTCTTCACTCAAGATGGAGATGCTCCAACCACAGTTAATGGAAATATTTCTGGCCTAA
AACCTGGACTTCATGGCTTCCATGTCCATGCCCTTGGTGATACCACAAATGGCTGTATGTCAACAGGACCACATTACAATCCTGCTGGTA
AGGAGCATGGTGCTCCTGAAGATGAGGTGCGTCATGCTGGTGATCTTGGTAACATCACAGTTGGAGAAGATGGTACTGCATCTTTTACTA
TTACCGACAAGCAGATTCCTCTCACTGGTCCACAGTCCATCATTGGAAGAGCTGTTGTTGTTCATGCTGATCCTGATGATCTTGGAAAGG
GAGGACATGAGCTCAGTAAAAGCACCGGAAATGCTGGCGGAAGGATTGCTTGTGGTATTATTGGCCTCCAGGGTTAACTGCTCCGGTGAG
GTGAAGATTCAGCAACTAGCGGTGGTGTCTGTCTTAGAATAAAGTTATATTGGAGCTGCTGAGCCTTGTTTTCTATGTATTTATCATTTG
ACGCCTTTTGAATTGGGGTTGAACCATTCATAATACATGACTGTAGTGCTGCTTTTCAGTGGATGTTGTACTAGTTTTTGCCGATCATTA
ACCATAAAAAAACATGGGCTGTGTTAGCTTTGCTGGTTTCTTAAATTTGAGTGGATGGTTTGAAAACTAGACAAAATTTAGATGAATTTG
CAGATTACAGTGCCTGCAGTTTTTGTTCATAAA

[Blast] [AA Translation]

Associated Loci (2)

Locus symbol	Locus name	Gene activity
sod	superoxide dismutase
SODCC1	Superoxide dismutase [Cu-Zn] 1

Genomic locations (0)

None

Library representation (35)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	4
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	20
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	14
Solanum lycopersicum	LA	Leaf Mature leaves	6589	1
Solanum lycopersicum	LE12	Fruit 12 days post anthesis	276	1
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	4
Solanum lycopersicum	LeMiToFr02	fruit	18697	2
Solanum lycopersicum	LePU	Pericarp Turning stage of fruit ripening.	1542	2
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	12
Solanum lycopersicum	Sl_FruitQTL	late maturation (breaker and red ripe)	663	1
Solanum lycopersicum	Sl_RootInf01	root and collar Three weeks old	385	1
Solanum lycopersicum	Sl_RootInf02	root and collar Three weeks old	333	1
Solanum lycopersicum	Sl_RootN	Roots 5 weeks	165	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	5
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	10
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	4
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	13
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	19
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	8
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	6
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	8
Solanum lycopersicum	cTOS	suspension cultures	8026	1
Solanum lycopersicum	cTSB	seed	1880	3
Solanum lycopersicum	cTSD	seed	1504	1
Solanum lycopersicum	vSlycmRNA		8362	5
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (168)

Alignment image suppressed for unigene with 168 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (3)

Annotations (manual: 3 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (3)

Unigene	Build
SGN-U314403	Tomato 200607 #1
SGN-U314405	Tomato 200607 #1
SGN-U338647	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: