Sol Genomics Network

Unigene SGN-U581429

Unigene Basic Information

Unigene ID:	SGN-U581429
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 860 bp

>SGN-U581429 Tomato 200607 #2 (81 members)
GAAACGGTAAGTTCTTTGGGGGCTCTCCACTGCATATTAGGGTTTTCGCTACAGAGTATTCGTCGCCGTTCAGTTTATCTTCATTTGCAA
ACCCTCAATCATGGCGGAGCAGACGGAGAAGGCGTTTTTGAAGCAGCCAGGTGTTTTTCTAAGCTCTAAGAAGACCGGGAAGGGAAAGAG
GCCAGGAAAGGGAGGCAATCGATACTTTAAGAGTATCGGTTTAGGATTCAAGACTCCTCGTGAGGCTACTGAAGGTACATATATTGACAA
GAAATGCCCATTCACTGGCAATGTTTCTATCCGAGGCCGTATCCTTGCTGGTACATGCCACAGTGCTAAGATGAACAGGACCATCATTGT
TCGACGCAATTACCTACATTATGTCAAGAAGTATCAGAGATATGAGAAGAGACACTCCAATATTCCAGCTCACATATCACCATGCTTCCG
TGTGAAAGAGGGAGATCATGTTACTATTGGCCAGTGCAGGCCTTTATCCAAAACTGTGAGGTTCAATGTATTGAAGGTGATTCCAGCCGG
TTCTGGTGGTGTTGGGAAAAAAGCTTTTACCGGAATGTGAACTTGATTGTTTCTATTTTAATGTTTACATCTAGAAATGATGTCAAGGCA
TATTTGCTTTTGCTGAATTCTAGTCTTCATTTATACTCCTTTCTGAGATTCAAATTTTGAAACTTTATGCTAGTAGTAACAAGCTTTTCT
TTCCTATTGAGATTTGAGCCCATATATGTACTGTTCATCTTGTGAGAGGTTTGGTGCTTGAACCTTCTTTAAAAAAAAAAAGTACTTATG
GTGATTTTGGTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	4
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	2
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	1
Solanum lycopersicum	LeMiToLf01	leaf	30679	4
Solanum lycopersicum	LePS	root 5 weeks old plants	823	1
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	10
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	5
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	4
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	9
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	5
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	5
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	6
Solanum lycopersicum	cTOS	suspension cultures	8026	2
Solanum lycopersicum	vSlycmRNA		8362	2
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (81)

Alignment image suppressed for unigene with 81 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (7)

Annotations (manual: 4 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (2)

Unigene	Build
SGN-U312918	Tomato 200607 #1
SGN-U334012	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: