Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580345 in the current build, Tomato 200607 #2

Unigene SGN-U312531

Unigene Basic Information

Unigene ID:	SGN-U312531
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312531
mRNA sequence:	Length: 1244 bp

>SGN-U312531 Tomato 200607 #1 (165 members)
CACACTTGTTAGTTTCTAATAAACAGAAACAAACAGCAGCAGAGAACTGATCAGAAAAACAAAAACAAAATGGCAGCCTCTCTACAAGCA
GCTGCTACTCTTATGCAACCAACTAAGGTTGGTGGTGTCTCTGCCAGAAACAACTTGCCATTGAGGTCAGCTCAAAGTTTGAGCAAGGCA
TTTGGTCTTGAACCATCTGCATCCAAGCTTTCTTGCTCTTTGCAAGCTGATCTTAAAGATTTTGCTCAGAAATGCACTGATGCTGCCAAG
ATTGCAGGATTTGCCCTTGCCACTTCTGCCCTTGTTGTCTCAGGAGCTAATGCTGAAGGAGTTCCAAAACGTCTAACCTTTGATGAGATC
CAGAGCAAGACATACATGGAAGTAAAGGGAACTGGAACAGCAAACCAGTGCCCTACCATAGATGGAGGTGTTGATAGCTTTTCCTTCAAG
CCAGGCAAATACAACGCCAAGAAGTTCTGCTTAGAGCCAACATCATTCACCGTCAAGGCAGAGGGCGTAAGCAAAAATTCAGCCCCAGAC
TTCCAAAAGACCAAGCTTATGACTCGCTTAACCTACACTTTGGATGAGATTGAGGGACCGTTTGAAGTATCTCCTGATGGCACTGTTAAA
TTTGAGGAGAAGGATGGAATTGATTACGCTGCTGTTACTGTCCAGCTTCCTGGTGGTGAGCGTGTTCCGTTCCTCTTCACCATCAAACAA
CTTGTGGCATCTGGAAAGCCTGAGAGCTTCAGTGGCGACTTCCTTGTGCCATCCTACAGAGGTTCATCGTTTCTTGACCCAAAAGGCAGG
GGTGGATCCACTGGTTACGACAATGCTGTTGCATTGCCAGCTGGAGGCAGAGGAGATGAGGAGGAGCTCCAGAAAGAGAACGTAAAGAAT
ACCGCGTCTTTAACAGGAAAGATCACATTTACTGTTACCAAGAGCAACCCACAGACTGGTGAGGTGATTGGAGTGTTTGAGAGCATTCAG
CCATCTGATACTGATCTGGGGGCAAAGACTCCTAAGGATGTAAAAATCCAGGGTATCTGGTATGCCCAGCTTGAATCATAGACAGATCTT
AGACTTTGTGGATCATTTCTTCGTTTTTGATTTTGTTATAAGTTACTACAAGGTTTCAACTTTCTATGACCCAATTGGATAAGTAATGAG
ACAACTATCTTCCTGTAAAAAAAAAAAAAAAAAAAAAAAATCCATTAACATACTGAGTTGGCAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
X52427	33 kDa oxygen-evolving protein

Genomic locations (0)

None

Library representation (26)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	7
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	LA	Leaf Mature leaves	6589	15
Solanum lycopersicum	LB	Leaf Mature leaves	3316	6
Solanum lycopersicum	LC	Leaf Mature leaves	5712	3
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	5
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	4
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	14
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	8
Solanum lycopersicum	cLES	leaf 4 weeks	5243	10
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	33
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	9
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	10
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	12
Solanum lycopersicum	cTSC	seed	2256	2
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	7

mRNA member sequences (165)

Alignment image suppressed for unigene with 165 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101882	Photosystem II manganese-stabilizing protein PsbO - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898) - Biological Process: photosystem II stabilization (GO:0042549)	31
2	118769	Photosystem II manganese-stabilizing protein PsbO - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898) - Biological Process: photosystem II stabilization (GO:0042549)	31
5	129210	Photosystem II manganese-stabilizing protein PsbO - Molecular Function: calcium ion binding (GO:0005509) - Cellular Component: oxygen evolving complex (GO:0009654) - Biological Process: photosynthesis (GO:0015979) - Cellular Component: extrinsic to membrane (GO:0019898) - Biological Process: photosystem II stabilization (GO:0042549)	31

Preceding Unigenes (1)

Unigene	Build
SGN-U212742	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: