Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580936 in the current build, Tomato 200607 #2

Unigene SGN-U312839

Unigene Basic Information

Unigene ID:	SGN-U312839
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312839
mRNA sequence:	Length: 747 bp

>SGN-U312839 Tomato 200607 #1 (62 members)
TTGCTGAAAAAAAAATCAAAATTGAGTAGGAGGATTTCTGAGGGATTTTGTGTACGGAAATGGCATCCAAGAGGATTCTGAAAGAGCTCA
AGGATCTCCAGAAAGATCCTCCTACCTCTTGCAGTGCTGGCCCAGTTGCGGAAGATATGTTTCACTGGCAAGCGACACTTATGGGTCCAT
CTGACAGTCCTTATGCTGGTGGAGTGTTTCTTGTGACCATTCATTTTCCACCCGATTATCCATTTAAGCCTCCAAAGGTAGCTTTTAGGA
CAAAGGTTTTTCACCCAAACATCAACAGCAATGGCAGCATTTGCCTCGACATTCTGAAGGAACAATGGAGCCCGGCACTTACGATTTCCA
AGGTGCTGCTGTCAATCTGCTCTCTGCTAACAGACCCTAATCCCGATGATCCTTTGGTGCCCGAGATTGCTCATATGTACAAGACTGATA
AAAGCAAGTACGAAGCAACTGCTCGGAGCTGGACCCAAAAGTATGCAATGGGTTAGTTGCTGCTCAGACCCATGTCCGGAGGGGGGCTCC
TTTCCCTCTGAGTTTGTGGTCATTGTCTATGACATATTAAGAAGTGTTTGTTTCTTCATGTATAATCAACTTGAGAGGAAAGCTTGAATT
GTGGCCTCACTGTGAAACATTGAGTTTGCTGTGTCTGTAAACCTTTAATGGCTTTTAAATCCTGTGGATGGGTTCAAACTAGTAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	11
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	6
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	12
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	5
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	5
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	1

mRNA member sequences (62)

Alignment image suppressed for unigene with 62 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 2 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101402	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	283
2	118431	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	197
5	128961	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	109

Preceding Unigenes (1)

Unigene	Build
SGN-U213334	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: