Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581484 in the current build, Tomato 200607 #2

Unigene SGN-U313160

Unigene Basic Information

Unigene ID:	SGN-U313160
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313160
mRNA sequence:	Length: 994 bp

>SGN-U313160 Tomato 200607 #1 (17 members)
CTCGTGCCGTCCAACTCTTCTCTGCCTCTTACTTGTATCTGCTAGCGGCGGCAGTGAATCTATCTCAAACCCTAATCTCAACATGGCGAC
GCCTCAGATTAGTAAAAAGCGAAAGTTTGTTGCGGATGGAGTTTTTTTTGCGGAGTTGAACGAAGTGCTTACAAGAGAGCTGGCGGAGGA
TGGTTACTCGGGAGTTGAAGTTAGGGTTACTCCCGTGCGAACTGAAATCATCATTAGAGCCACTCGTACTCAGAACGTTCTTGGTGAGAA
AGGTAGGAGGATCAGGGAGCTGACTTCAGTTGTTCAGAAGCGTTTTAATTTCAAGGAAAACACTGTTGAGCTCTATGCTGAGAAAGTCAA
CAATAGGGGTCTCTGTGCCATTGCTCAGGCAGAGTCACTGCGATACAAGTTACTTGGAGGACTTGCTGTCCGAAGGGCTTGCTATGGTGT
TCTGAGATTTGTAATGGAGAGTGGAGCCAAGGGATGCGAGGTGATTGTTAGTGGAAAGCTCCGTGCTCAGCGTGCCAAGTCCATGAAGTT
TAAGGACGGTTACATGATTTCTTCTGGCCAACCGGTTAAAGAATACATTGATGCAGCTGTAAGGCATGTTCTACTAAGGCAGGGTGTGCT
TGGTATCAAAGTCAAGATCATGCTTGACTGGGATCCTAAGGGTAAACAAGGGCCTATGACTCCATTGCCAGATTTGGTGACTATTCATCC
ACCCAAGGAGGAAGAAGAGTTTGTTGTTCCTCCTCCTATGATAGCTGCTCCCGCCATCGAGGTTCTTCCTGTGGCATAAAAACCTGTGCT
ATGATGTTATCTTCGTTCTTGAGAACTACTGCACTAGCTGGCTTGTTATTTATTTTCCTTTTTCACTGCCGAATACTAGATTTTACATAG
TGAACCGTTTTGCTCTAGTTTCTGTTATGTAAGATACTGACTGGCAAGCATTTTTGTTAATCTTCATCTCCCCTAATCTGGTGGGACTTT
GAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (12)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	3
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (17)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102210	KH prokaryotic type Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	19
2	119191	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19
5	129545	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U213354	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: