Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577253 in the current build, Tomato 200607 #2

Unigene SGN-U312690

Unigene Basic Information

Unigene ID:	SGN-U312690
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312690
mRNA sequence:	Length: 879 bp

>SGN-U312690 Tomato 200607 #1 (160 members)
CTCACATATTAAAACCCCATCAACTCCTACTCCCCTTTTCTTGATTCCAAATTTTCAATCACAAAAGCAACAACAAGAAGCATATTAATA
AACAATGGCCACTGTTACCTCTGCTGCTGTTGCTATTCCATCTTTCACTGGCCTTAAGGCTGGTGCTTCATCATCTTCCAGAGTTAGCAC
CGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGATTGACTGTGAAGGCGTCTTTGAAAGATGTCGGTGCTGTGGTTGCTGCCAC
CGCTGTTAGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGCTTGGTGGTGATGATGGGAGTCTAGCTTTTATTCCTGGGAA
CTTCAGCGTTAGTGCTGGTGAGAAAATTACATTCAAGAACAATGCAGGGTTCCCACACAACGTCGTATTTGATGAAGATGAAATCCCAGC
TGGTGTGGATGCTAGTAAGATTTCCATGTCTGAAGAGGATCTTCTGAATGCAGCAGGAGAGACATACAGTGTCACTTTGAGTGAGAAAGG
AACTTACACTTTCTACTGTGCACCTCACCAGGGAGCTGGAATGGTTGGCAAAGTTACTGTCAACTAATTTTTTTCACACCTCTGTTTTGT
AAAAGTTGATTTGAGTTCCCATCAATTTCAACATTTTCCTTTTAGTATTGCCCTTCTCTTTTTGAGGTGTAATGAAAACTCAGGAAATTA
AAGTTGCATATGTATCCATGTAATGTCATTTTGTGATTAATACCAGCTTTTTTGGACTGTAAAAAAAAAAAAAAAAAAAAAAAACAACCT
TCCTCCTGATGGTAAAATAACATACCCGTTTCAGTTGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
X13934	pre-plastocyanin

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	8
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LA	Leaf Mature leaves	6589	6
Solanum lycopersicum	LB	Leaf Mature leaves	3316	14
Solanum lycopersicum	LC	Leaf Mature leaves	5712	19
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	9
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	5
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	14
Solanum lycopersicum	cLER	leaf 4 weeks	5127	26
Solanum lycopersicum	cLES	leaf 4 weeks	5243	16
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	19
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	11
Solanum lycopersicum	cTSC	seed	2256	1
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	3

mRNA member sequences (160)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (1)

Expression Data (7)

Annotations (manual: 5 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102572	Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118)	12
2	119779	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12
5	130104	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U213031	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: