Sol Genomics Network

Unigene SGN-U578175

Unigene Basic Information

Unigene ID:	SGN-U578175
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 762 bp

>SGN-U578175 Tomato 200607 #2 (61 members)
GGGAAAACCCTAATCGGCAGAAGCAGCTTCTTCTCTCTCAGGTAAGCTGGTGTTTTTTTCCCTAGGGTTTCAGAATTAAACATATCCAAA
TGGCTCCTAAAGCTGATTCGACCAAGAAGTCTGACCCTAAGGCTCAAGCCGTTAAGGCTGCCAAGGCTGTCAAGTCAGGATCAACCTTCA
AGAAGAAGTCACAGAAGATCAGGACAAAGGTTACATTCCACCGTCCTAGGACTTTGAAGAAGGATAGAAGCCCCAAGTATCCTCGTGTTA
GTGCACCTGGAAGGAACAAACTTGATCAATATGCTATTCTAAAGTATCCTCTCACCACCGAGTCTGCAATGAAGAAGATTGAAGACAATA
ACACCCTTGTTTTCATTGTTGACATCAAAGCTGATAAGAAGAAGATCAAGGCTGCTGTGAAGAAGATGTATGACATTCAGACTAAGAAAA
TCAATACCTTGATCAGGCCTGATGGAACTAAGAAGGCATATGTGAGGTTGACTCCAGACTATGACGCTTTGGATGTGGCCAACAAAATCG
GGATCATCTAAATTAGTTTTCCTGTTTAGAATTTTGAGGAGAATTTAGAATTTCATGAAACACTTTAATGGAAGTGCCTTGTGTTTTGAA
TTTTGAATTTTGCTTTCCTGTTTTATTCCATATTTTTGTTATAATAGAATTCAACCTTGTGCTCCTAGTGAGTACTTGACATATTTGATT
TGCCCCATGATTTATCAGATAGTATCATATAGTTATTTATAC

[Blast] [AA Translation]

Associated Loci (2)

Locus symbol	Locus name	Gene activity
db288	db288
Solyc09g005720	Solyc09g005720

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	2
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	7
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	LeMiToFr02	fruit	18697	6
Solanum lycopersicum	LeMiToLf01	leaf	30679	1
Solanum lycopersicum	LePU	Pericarp Turning stage of fruit ripening.	1542	1
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	5
Solanum lycopersicum	Sl_RootInf01	root and collar Three weeks old	385	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	4
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (61)

Alignment image suppressed for unigene with 61 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U314146	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: