Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U577715 in the current build, Tomato 200607 #2

Unigene SGN-U213045

Unigene Basic Information

Unigene ID:	SGN-U213045
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	213045
mRNA sequence:	Length: 733 bp

>SGN-U213045 Lycopersicon Combined #3 (101 members)
GCACGAGCCAAAACCCTAGCCGCAGTCACTTCCATAGGAGCTTAGAAGCCAATTCATTCTCGAAGCCATGGCGGAAGTTGAAGCTGATGT
TGCGACCGGACAGCCAAGGAAGAGAACATTCAAGAAGTTCAGCTACAGAGGAGTAGATCTGGATTCTCTTCTTGACATGTCTACTGATGA
GCTTGTTAAGCTTTACCCTGCTCGTCCTCGCAGAAGGTTCCAGAGGGGTTTGAAGAGGAAGCCTATGGCTTTGATCAAGAAGCTGCGCAA
GGCGAAACGTGAGGCCCCACCTGGTGAGAAGCCAGAGGTTGTGAGAACACATTTGAGGAACATGATCATTGTTCCTGAGATGATTGGAAG
TGTCATTGGAATCTACAATGGAAAAACTTTCAATCAAATTGAGGTCAAGCCTGAGATGATTAGTCACTACTTAGCTGAGTTCTCCATCTC
ATACAAGCCTGTCAAGCACGGTAGGCCCGGTATTGGTGCTACTCACTCTTCAAGGTTCATTCCATTGAAGTGATTCATCCAAATCTGTCT
ACATGGTTTCTAGTAATACTAGTACTTTTGTTTTACTGCAATTTTGATGAGAACAGTGGATACTGAATGGTTCTTTGTTTGAGACTAGTA
ATTTGCTGATACATTGCAACATTTCAATGATTGTGCTTCTAAAAAAAAAAAAAAAAAAAATTTTTGTACCTTTTTGTTTCTCTGAAAAAA
AAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (22)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	4
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	21
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	5
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	5
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	4
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	5
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	5
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	8
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	8
Solanum lycopersicum	cTOS	suspension cultures	8026	10
Solanum lycopersicum	cTSB	seed	1880	2

mRNA member sequences (101)

Alignment image suppressed for unigene with 101 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (4)

Annotations (manual: 1 | blast: 2 | go: 5 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	671	Ribosomal_S15e/a	28
2	22476	Ribosomal_S15e/a	28
5	56663	Ribosomal_S15e/a	27

Preceding Unigenes (1)

Unigene	Build
SGN-U143621	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: