Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U580194, SGN-U581484, and SGN-U592830 in the current build, Tomato 200607 #2

Unigene SGN-U313162

Unigene Basic Information

Unigene ID:	SGN-U313162
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313162
mRNA sequence:	Length: 1135 bp

>SGN-U313162 Tomato 200607 #1 (88 members)
AATCGGCCGAATTGAAGCAGGCTGAATTAATAAGAAAAGAGAGCCCAACTAGTAACCTGCCTTAAATCTTTGACAAACCCTTTCTCCCTT
GTCCTAATCCAACTCTTCTCTGCCTCTCATTTGTATCTTCCATCGGCCGCAGTGAATCAATATCAAACCCTAATCTCAACATGGCGACGC
CTCAGATTAGTAAAAAGCGAAAGTTTGTTGCGGATGGAGTTTTTTTTGCGGAGTTGAACGAAGTGCTTACAAGAGAGCTGGCGGAGGATG
GTTACTCGGGAGTTGAAGTTAGGGTTACTCCCGTGCGAACTGAAATCATCATTAGAGCCACTCGTACTCAGAACGTTCTTGGTGAGAAAG
GTAGGAGGATCAGGGAGCTGACTTCAGTTGTTCAGAAGCGTTTTAATTTCAAGGAAAACACTGTTGAGCTCTATGCTGAGAAAGTCAACA
ATAGGGGTCTCTGTGCCATTGCTCAGGCAGAGTCACTGCGATACAAGTTACTTGGAGGACTTGCTGTCCGAAGGGCTTGCTATGGTGTTC
TGAGATTTGTAATGGAGAGTGGAGCCAAGGGATGCGAGGTGATTGTTAGTGGAAAGCTCCGTGCTCAGCGTGCCAAGTCCATGAAGTTTA
AGGACGGTTACATGATTTCTTCTGGCCAACCGGTTAAAGAATACATTGATGCAGCTGTAAGGCATGTTCTACTAAGGCAGGGTGTGCTTG
GTATCAAAGTCAAGATCATGCTTGACTGGGATCCTAAGGGTAAACAAGGGCCTATGACTCCATTGCCAGATTTGGTGACTATTCATCCAC
CCAAGGAGGAAGAAGAGTTTGTTGTTCCTCCTCCTATGATAGCTGCTCCCGCCATCGAGGTTCTTCCTGTGGCATAAAAACCTGTGCTAT
GATGTTATCTTCGTTCTTGAGAACTACTGCACTAGCTGGCTTGTTATTTATTTTCCTTTTTCACTGCCGAATACTAGATTTTACATAGTG
AACCGTTTTGCTCTAGTTTCTGTTATGTAAGATACTGACTGGCAAGCATTTTTGTTAATCTTCATCTCCCCTAATCTGTTGTGACTTTGA
AATGAAATTGTTTTTGAATTTCACTTTATTTAATGTAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (29)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	6
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	6
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	11
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	3
Solanum lycopersicum	cLES	leaf 4 weeks	5243	5
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	6
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	3
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	9
Solanum lycopersicum	cTOS	suspension cultures	8026	5
Solanum lycopersicum	cTSC	seed	2256	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (88)

Alignment image suppressed for unigene with 88 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102210	KH prokaryotic type Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	19
2	119191	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19
5	129545	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U213354	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: