Sol Genomics Network

Unigene SGN-U581484

Unigene Basic Information

Unigene ID:	SGN-U581484
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 1020 bp

>SGN-U581484 Tomato 200607 #2 (121 members)
GCCTCGTGCCGTCCAACTCTTCTCTGCCTCTTACTTGTATCTGCTAGCGGCGGCAGTGAATCTATCTCAAACCCTAATCTCAACATGGCG
ACGCCTCAGATTAGTAAAAAGCGAAAGTTTGTTGCGGATGGAGTTTTTTTTGCGGAGTTGAACGAAGTGCTTACAAGAGAGCTGGCGGAG
GATGGTTACTCGGGAGTTGAAGTTAGGGTTACTCCCGTGCGAACTGAAATCATCATTAGAGCCACTCGTACTCAGAACGTTCTTGGTGAG
AAAGGTAGGAGGATCAGGGAGCTGACTTCAGTTGTTCAGAAGCGTTTTAATTTCAAGGAAAACACTGTTGAGCTCTATGCTGAGAAAGTC
AACAATAGGGGTCTCTGTGCCATTGCTCAGGCAGAGTCACTGCGATACAAGTTACTTGGAGGACTTGCTGTCCGAAGGGCTTGCTATGGT
GTTCTGAGATTTGTAATGGAGAGTGGAGCCAAGGGATGCGAGGTGATTGTTAGTGGAAAGCTCCGTGCTCAGCGTGCCAAGTCCATGAAG
TTTAAGGACGGTTACATGATTTCTTCTGGCCAACCGGTTAAAGAATACATTGATGCAGCTGTAAGGCATGTTCTACTAAGGCAGGGTGTG
CTTGGTATCAAAGTCAAGATCATGCTTGACTGGGATCCTAAGGGTAAACAAGGGCCTATGACTCCATTGCCAGATTTGGTGACTATTCAT
CCACCCAAGGAGGAAGAAGAGTTTGTTGTTCCTCCTCCTATGATAGCTGCTCCCGCCATCGAGGTTCTTCCTGTGGCATAAAAACCTGTG
CTATGATGTTATCTTCGTTCTTGAGAACTACTGCACTAGCTGGCTTGTTATTTATTTTCCTTTTTCACTGCCGAATACTAGATTTTACAT
AGTGAACCGTTTTGCTCTAGTTTCTGTTATGTAAGATACTGACTGGCAAGCATTTTTGTTAATCTTCATCTCCCCTAATCTGTTGTGACT
TTGAAATGAAATTGTTTTTGAATTTCACTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (37)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	7
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	8
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	2
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	1
Solanum lycopersicum	LeMiToFr02	fruit	18697	4
Solanum lycopersicum	LeMiToLf01	leaf	30679	5
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	2
Solanum lycopersicum	LeWCAD	Seedling Two-week-old seedings	227	1
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	3
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	12
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	6
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	8
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	5
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	11
Solanum lycopersicum	cTOS	suspension cultures	8026	5
Solanum lycopersicum	cTSC	seed	2256	1
Solanum lycopersicum	vSlycmRNA		8362	2
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (121)

Alignment image suppressed for unigene with 121 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (3)

Unigene	Build
SGN-U313160	Tomato 200607 #1
SGN-U313161	Tomato 200607 #1
SGN-U313162	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: